header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050425-3
Morpholino Name: MO2-lft1
Target: lft1 (1)
Previous Name: lft1 MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGCGCGGACTGAAGTCATCTTTTCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: lefty1 start codon morpholino
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-lft1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-lft1
Expressed Gene Anatomy Figures
lft1 Fig. 5 with image from Wang et al., 2008
spaw Fig. 3 with imageFig. 5 with image from Wang et al., 2008
PHENOTYPE
Phenotype resulting from MO2-lft1
Phenotype of all Fish created by or utilizing MO2-lft1
OTHER MO2-lft1 MORPHOLINO PAGES No links to external sites
CITATIONS (2)