Morpholino

MO1-stk36

ID
ZDB-MRPHLNO-050308-9
Name
MO1-stk36
Previous Names
  • fu MO1 (1)
Target
Sequence
5' - TGGTACTGATCCATCTCCAGCGACG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino targeting stk36.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-stk36
Expressed Gene Anatomy Figures
gata1a Fig. 7 with image from Xia et al., 2010
gsc Fig. 7 with image from Xia et al., 2010
ptch2 Fig. 6 from Wolff et al., 2003
Phenotype
Phenotype resulting from MO1-stk36
Phenotype Fish Figures
atrium inverted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. S11 from Wilson et al., 2009
axoneme assembly disrupted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 3 from Wilson et al., 2009
cilium or flagellum-dependent cell motility disrupted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 3 from Wilson et al., 2009
determination of left/right symmetry disrupted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 3,  Fig. S11 from Wilson et al., 2009
eye fused with eye, abnormal AB + MO1-stk36 + MO4-tp53 text only from Wilson et al., 2009
fast muscle cell increased amount, abnormal WT + MO1-stk36 Fig. 6 from Wolff et al., 2003
floor plate formation disrupted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 2,  Fig. S5 from Wilson et al., 2009
growth delayed, abnormal TU + MO1-stk36 Fig. 7 with image from Xia et al., 2010
gut position, abnormal AB + MO1-stk36 + MO4-tp53 Fig. S11 from Wilson et al., 2009
heart looping disrupted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 3,  Fig. S11 from Wilson et al., 2009
heart tube inverted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 3 from Wilson et al., 2009
heart tube straight, abnormal AB + MO1-stk36 + MO4-tp53 Fig. S11 from Wilson et al., 2009
heart tube symmetry, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 3 from Wilson et al., 2009
Kupffer's vesicle altered number of ciliated cell axonemal microtubule, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 3 from Wilson et al., 2009
Kupffer's vesicle axoneme disorganized, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 3 from Wilson et al., 2009
lateral floor plate aplastic, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 2,  Fig. S5 from Wilson et al., 2009
liver inverted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. S11 from Wilson et al., 2009
liver position, abnormal AB + MO1-stk36 + MO4-tp53 Fig. S11 from Wilson et al., 2009
medial floor plate morphology, abnormal AB + MO1-stk36 + MO4-tp53 Fig. S5 from Wilson et al., 2009
muscle pioneer absent, abnormal WT + MO1-stk36 Fig. 6 from Wolff et al., 2003
nervous system necrotic, abnormal TU + MO1-stk36 Fig. 7 with image from Xia et al., 2010
pancreas inverted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. S11 from Wilson et al., 2009
pancreas position, abnormal AB + MO1-stk36 + MO4-tp53 Fig. S11 from Wilson et al., 2009
regulation of smoothened signaling pathway disrupted, abnormal WT + MO1-stk36 Fig. 6 from Wolff et al., 2003
smoothened signaling pathway disrupted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 2 from Wilson et al., 2009
somite U-shaped, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 2 from Wilson et al., 2009
somite muscle pioneer absent, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 2 from Wilson et al., 2009
trunk decreased length, abnormal TU + MO1-stk36 + MO4-tp53 Fig. 7 with image from Xia et al., 2010
whole organism wholly dorsalized, abnormal TU + MO1-stk36 + MO4-tp53 Fig. 7 with image from Xia et al., 2010
Phenotype of all Fish created by or utilizing MO1-stk36
Phenotype Fish Conditions Figures
lateral floor plate aplastic, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2,  Fig. S5 from Wilson et al., 2009
smoothened signaling pathway disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2 from Wilson et al., 2009
floor plate formation disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2,  Fig. S5 from Wilson et al., 2009
eye fused with eye, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions text only from Wilson et al., 2009
axoneme assembly disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
cilium or flagellum-dependent cell motility disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
heart tube symmetry, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
medial floor plate morphology, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S5 from Wilson et al., 2009
somite muscle pioneer absent, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2 from Wilson et al., 2009
heart looping disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3,  Fig. S11 from Wilson et al., 2009
heart tube straight, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
Kupffer's vesicle altered number of ciliated cell axonemal microtubule, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
determination of left/right symmetry disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3,  Fig. S11 from Wilson et al., 2009
heart tube inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
pancreas position, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
Kupffer's vesicle axoneme disorganized, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
atrium inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
somite U-shaped, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2 from Wilson et al., 2009
pancreas inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
liver position, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
gut position, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
liver inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
nervous system necrotic, abnormal TU + MO1-stk36 standard conditions Fig. 7 with image from Xia et al., 2010
growth delayed, abnormal TU + MO1-stk36 standard conditions Fig. 7 with image from Xia et al., 2010
whole organism wholly dorsalized, abnormal TU + MO1-stk36 + MO4-tp53 standard conditions Fig. 7 with image from Xia et al., 2010
trunk decreased length, abnormal TU + MO1-stk36 + MO4-tp53 standard conditions Fig. 7 with image from Xia et al., 2010
muscle pioneer absent, abnormal WT + MO1-stk36 standard conditions Fig. 6 from Wolff et al., 2003
regulation of smoothened signaling pathway disrupted, abnormal WT + MO1-stk36 standard conditions Fig. 6 from Wolff et al., 2003
fast muscle cell increased amount, abnormal WT + MO1-stk36 standard conditions Fig. 6 from Wolff et al., 2003
fast muscle cell decreased amount, abnormal gli1ts269/ts269 + MO1-stk36 standard conditions Fig. 6 from Wolff et al., 2003
muscle pioneer absent, abnormal gli1ts269/ts269 + MO1-stk36 standard conditions Fig. 6 from Wolff et al., 2003
fast muscle cell increased amount, abnormal WT + MO1-stk36 + MO1-sufu standard conditions Fig. 7 from Wolff et al., 2003
fast muscle cell increased amount, abnormal WT + MO1-stk36 + MO2-gli2a standard conditions Fig. 6 from Wolff et al., 2003
muscle pioneer absent, abnormal WT + MO1-stk36 + MO2-gli2a standard conditions Fig. 6 from Wolff et al., 2003
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.