header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-041207-6
Morpholino Name: MO1-notch2
Target: notch2 (1)
Previous Name: MO-notch2-1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGGTGAACACTTACTTCATGCCAAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: designed to bind to exon-intron region, predicted to generate a premature stop codon after the last exon 7 codon, thus deleting the entire ankyrin repeat domain.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-notch2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-notch2
Expressed Gene Anatomy Figures
dlx2a Fig. 2 with imageFig. 4 with image from Zuniga et al., 2010
dlx3b Fig. 2 with image from Zuniga et al., 2010
dlx5a Fig. 2 with image from Zuniga et al., 2010
ephb2a Fig. S4 from Geudens et al., 2010
flt4 Fig. S4 from Geudens et al., 2010
hey1 Fig. 4 with image from Zuniga et al., 2010
jag1b Fig. 4 with image from Zuniga et al., 2010
notch2 Fig. 4 with image from Zuniga et al., 2010
PHENOTYPE
Phenotype resulting from MO1-notch2
Phenotype of all Fish created by or utilizing MO1-notch2
Phenotype Fish Conditions Figures
thoracic duct absent, abnormal WT + MO1-notch2 standard conditions Fig. 1 from Geudens et al., 2010
opercle curved, abnormal WT + MO1-notch2 standard conditions Fig. 1 with image from Zuniga et al., 2010
opercle decreased width, abnormal WT + MO1-notch2 standard conditions Fig. 1 with image from Zuniga et al., 2010
thoracic duct wholeness, abnormal WT + MO1-notch2 standard conditions Fig. 1 from Geudens et al., 2010
palatoquadrate cartilage truncated, abnormal WT + MO1-notch2 standard conditions Fig. 1 with image from Zuniga et al., 2010
hyosymplectic cartilage elongated, abnormal WT + MO1-notch2 standard conditions Fig. 1 with image from Zuniga et al., 2010
lymphangiogenesis disrupted, abnormal WT + MO1-notch2 standard conditions Fig. 1 from Geudens et al., 2010
hyosymplectic cartilage deformed, abnormal WT + MO1-notch2 standard conditions Fig. 1 with image from Zuniga et al., 2010
pancreatic B cell regeneration decreased rate, abnormal jh4Tg + MO1-notch2 chemical ablation: pancreatic B cell, chemical treatment by environment: metronidazole Fig. 5 from O'Hare et al., 2016
endocrine pancreas decreased size, abnormal nl1Tg + MO1-notch2 standard conditions Fig. S10 from O'Hare et al., 2016
enteroendocrine cell differentiation disrupted, abnormal nl1Tg + MO1-notch2 standard conditions Fig. S10 from O'Hare et al., 2016
endocrine pancreas EGFP expression decreased distribution, abnormal nl1Tg + MO1-notch2 standard conditions Fig. S10 from O'Hare et al., 2016
endocrine pancreas development disrupted, abnormal nl1Tg + MO1-notch2 standard conditions Fig. S10 from O'Hare et al., 2016
response to glucose decreased process quality, abnormal jh1Tg; jh2Tg + MO1-notch2 chemical treatment by environment: glucose Fig. 4 from O'Hare et al., 2016
pancreatic B cell decreased amount, abnormal jh1Tg; jh2Tg + MO1-notch2 standard conditions Fig. 2 from O'Hare et al., 2016
pancreatic B cell decreased amount, abnormal jh1Tg; jh2Tg + MO1-notch2 chemical treatment by environment: glucose Fig. 4 from O'Hare et al., 2016
glucose homeostasis disrupted, abnormal jh1Tg; jh2Tg + MO1-notch2 control Fig. S15 from O'Hare et al., 2016
glucose homeostasis disrupted, abnormal jh1Tg; jh2Tg + MO1-notch2 chemical treatment by environment: glucose Fig. S15 from O'Hare et al., 2016
pancreatic B cell decreased area, abnormal jh1Tg; jh2Tg + MO1-notch2 standard conditions Fig. 1 from O'Hare et al., 2016
symplectic decreased size, abnormal edn1tf216b/tf216b + MO1-notch2 standard conditions Fig. 6 with image from Zuniga et al., 2010
ceratohyal cartilage decreased size, abnormal edn1tf216b/tf216b + MO1-notch2 standard conditions Fig. 6 with image from Zuniga et al., 2010
Meckel's cartilage morphology, abnormal edn1tf216b/tf216b + MO1-notch2 standard conditions Fig. 6 with image from Zuniga et al., 2010
Meckel's cartilage decreased size, abnormal edn1tf216b/tf216b + MO1-notch2 standard conditions Fig. 6 with image from Zuniga et al., 2010
OTHER MO1-notch2 MORPHOLINO PAGES No links to external sites
CITATIONS (9)