ZFIN ID: ZDB-MRPHLNO-041207-6
Morpholino Name: MO1-notch2
Target: notch2 (1)
Previous Name: MO-notch2-1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGGTGAACACTTACTTCATGCCAAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: designed to bind to exon-intron region, predicted to generate a premature stop codon after the last exon 7 codon, thus deleting the entire ankyrin repeat domain.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-notch2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-notch2
Expressed Gene Anatomy Figures
dlx2a Fig. 2 with imageFig. 4 with image from Zuniga et al., 2010
dlx3b Fig. 2 with image from Zuniga et al., 2010
dlx5a Fig. 2 with image from Zuniga et al., 2010
ephb2a Fig. S4 from Geudens et al., 2010
flt4 Fig. S4 from Geudens et al., 2010
hey1 Fig. 4 with image from Zuniga et al., 2010
jag1b Fig. 4 with image from Zuniga et al., 2010
notch2 Fig. 4 with image from Zuniga et al., 2010
PHENOTYPE
Phenotype resulting from MO1-notch2
Phenotype Figures
endocrine pancreas EGFP expression decreased distribution, abnormal Fig. S10 from O'Hare et al., 2016
endocrine pancreas decreased size, abnormal Fig. S10 from O'Hare et al., 2016
endocrine pancreas development disrupted, abnormal Fig. S10 from O'Hare et al., 2016
enteroendocrine cell differentiation disrupted, abnormal Fig. S10 from O'Hare et al., 2016
glucose homeostasis disrupted, abnormal Fig. S15 from O'Hare et al., 2016
hyosymplectic cartilage deformed, abnormal Fig. 1 with image from Zuniga et al., 2010
hyosymplectic cartilage elongated, abnormal Fig. 1 with image from Zuniga et al., 2010
lymphangiogenesis disrupted, abnormal Fig. 1 from Geudens et al., 2010
opercle curved, abnormal Fig. 1 with image from Zuniga et al., 2010
opercle decreased width, abnormal Fig. 1 with image from Zuniga et al., 2010
palatoquadrate cartilage truncated, abnormal Fig. 1 with image from Zuniga et al., 2010
pancreatic B cell decreased amount, abnormal Fig. 2 from O'Hare et al., 2016
pancreatic B cell decreased area, abnormal Fig. 1 from O'Hare et al., 2016
thoracic duct absent, abnormal Fig. 1 from Geudens et al., 2010
thoracic duct wholeness, abnormal Fig. 1 from Geudens et al., 2010

Phenotype of all Fish created by or utilizing MO1-notch2
Phenotype Fish Conditions Figures
thoracic duct absent, abnormal WT + MO1-notch2 standard conditions Fig. 1 from Geudens et al., 2010
opercle curved, abnormal WT + MO1-notch2 standard conditions Fig. 1 with image from Zuniga et al., 2010
opercle decreased width, abnormal WT + MO1-notch2 standard conditions Fig. 1 with image from Zuniga et al., 2010
thoracic duct wholeness, abnormal WT + MO1-notch2 standard conditions Fig. 1 from Geudens et al., 2010
palatoquadrate cartilage truncated, abnormal WT + MO1-notch2 standard conditions Fig. 1 with image from Zuniga et al., 2010
hyosymplectic cartilage elongated, abnormal WT + MO1-notch2 standard conditions Fig. 1 with image from Zuniga et al., 2010
lymphangiogenesis disrupted, abnormal WT + MO1-notch2 standard conditions Fig. 1 from Geudens et al., 2010
hyosymplectic cartilage deformed, abnormal WT + MO1-notch2 standard conditions Fig. 1 with image from Zuniga et al., 2010
pancreatic B cell regeneration decreased rate, abnormal jh4Tg + MO1-notch2 chemical ablation: pancreatic B cell, chemical treatment by environment: metronidazole Fig. 5 from O'Hare et al., 2016
endocrine pancreas decreased size, abnormal nl1Tg + MO1-notch2 standard conditions Fig. S10 from O'Hare et al., 2016
enteroendocrine cell differentiation disrupted, abnormal nl1Tg + MO1-notch2 standard conditions Fig. S10 from O'Hare et al., 2016
endocrine pancreas EGFP expression decreased distribution, abnormal nl1Tg + MO1-notch2 standard conditions Fig. S10 from O'Hare et al., 2016
endocrine pancreas development disrupted, abnormal nl1Tg + MO1-notch2 standard conditions Fig. S10 from O'Hare et al., 2016
response to glucose decreased process quality, abnormal jh1Tg; jh2Tg + MO1-notch2 chemical treatment by environment: glucose Fig. 4 from O'Hare et al., 2016
pancreatic B cell decreased amount, abnormal jh1Tg; jh2Tg + MO1-notch2 standard conditions Fig. 2 from O'Hare et al., 2016
pancreatic B cell decreased amount, abnormal jh1Tg; jh2Tg + MO1-notch2 chemical treatment by environment: glucose Fig. 4 from O'Hare et al., 2016
glucose homeostasis disrupted, abnormal jh1Tg; jh2Tg + MO1-notch2 control Fig. S15 from O'Hare et al., 2016
glucose homeostasis disrupted, abnormal jh1Tg; jh2Tg + MO1-notch2 chemical treatment by environment: glucose Fig. S15 from O'Hare et al., 2016
pancreatic B cell decreased area, abnormal jh1Tg; jh2Tg + MO1-notch2 standard conditions Fig. 1 from O'Hare et al., 2016
symplectic decreased size, abnormal edn1tf216b/tf216b + MO1-notch2 standard conditions Fig. 6 with image from Zuniga et al., 2010
ceratohyal cartilage decreased size, abnormal edn1tf216b/tf216b + MO1-notch2 standard conditions Fig. 6 with image from Zuniga et al., 2010
Meckel's cartilage morphology, abnormal edn1tf216b/tf216b + MO1-notch2 standard conditions Fig. 6 with image from Zuniga et al., 2010
Meckel's cartilage decreased size, abnormal edn1tf216b/tf216b + MO1-notch2 standard conditions Fig. 6 with image from Zuniga et al., 2010
OTHER MO1-notch2 MORPHOLINO PAGESNo links to external sites
CITATIONS (9)