header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-041109-1
Morpholino Name: MO1-dlx3b
Target: dlx3b
Sequence:
5' - ATGTCGGTCCACTCATCCTTAATAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-dlx3b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-dlx3b
Expressed Gene Anatomy Figures
cldna Fig. 7 with image from Hans et al., 2004
pax2a Fig. 7 with image from Hans et al., 2004
stm Fig. 7 with image from Hans et al., 2007
PHENOTYPE
Phenotype resulting from MO1-dlx3b
Phenotype of all Fish created by or utilizing MO1-dlx3b
Phenotype Fish Conditions Figures
mandibular arch skeleton joint absent, abnormal WT + MO1-dlx3b standard conditions text only from Walker et al., 2006
otic vesicle decreased size, abnormal WT + MO1-dlx3b standard conditions Fig. 7 with image from Hans et al., 2007
otic vesicle decreased size, abnormal b1193Tg + MO1-dlx3b(AB) heat shock Fig. 7 with image from Hans et al., 2007
otic vesicle morphogenesis decreased process quality, abnormal AB + MO1-dlx3b + MO1-dlx4b standard conditions Fig. 2 with image from Hans et al., 2013
otic vesicle hair cell poorly differentiated, abnormal AB + MO1-dlx3b + MO1-dlx4b standard conditions Fig. 2 with image from Hans et al., 2013
otic vesicle inner ear receptor cell differentiation decreased process quality, abnormal AB + MO1-dlx3b + MO1-dlx4b standard conditions Fig. 2 with image from Hans et al., 2013
otic vesicle decreased size, abnormal AB + MO1-dlx3b + MO1-dlx4b standard conditions Fig. 2 with image from Hans et al., 2013
interhyal-epihyal joint absent, abnormal WT + MO1-dlx3b + MO1-dlx5a standard conditions Fig. 3 with image from Walker et al., 2006
mandibular arch skeleton joint absent, abnormal WT + MO1-dlx3b + MO1-dlx5a standard conditions Fig. 3 with image from Walker et al., 2006
otic vesicle aplastic, abnormal WT + MO1-dlx3b + MO2-foxi1 standard conditions Fig. 7 with image from Hans et al., 2007
otic vesicle hypoplastic, abnormal WT + MO1-dlx3b + MO2-foxi1 standard conditions Fig. 1 with image from Bhat et al., 2013
opercle fused with branchiostegal ray, abnormal AB + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b standard conditions Fig. 1 with image from Talbot et al., 2010
embryonic viscerocranium morphogenesis disrupted, abnormal AB + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b standard conditions Fig. 1 with image from Talbot et al., 2010
palatoquadrate cartilage morphology, abnormal AB + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b standard conditions Fig. 1 with image from Talbot et al., 2010
palatoquadrate cartilage morphology, abnormal Df(Chr01:hand2)s6/s6 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b(AB) standard conditions Fig. 7 with image from Talbot et al., 2010
embryonic viscerocranium morphogenesis disrupted, abnormal Df(Chr01:hand2)s6/s6 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b(AB) standard conditions Fig. 7 with image from Talbot et al., 2010
Meckel's cartilage decreased length, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b(AB) standard conditions Fig. 7 with image from Talbot et al., 2010
Meckel's cartilage morphology, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b(AB) standard conditions Fig. 7 with image from Talbot et al., 2010
mandibular arch skeleton joint absent, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b(AB) standard conditions Fig. 7 with image from Talbot et al., 2010
pharyngeal arch 2 skeleton joint absent, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b(AB) standard conditions Fig. 7 with image from Talbot et al., 2010
embryonic viscerocranium morphogenesis disrupted, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b(AB) standard conditions Fig. 7 with image from Talbot et al., 2010
Meckel's cartilage tapered, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b(AB) standard conditions Fig. 7 with image from Talbot et al., 2010
otic vesicle aplastic, abnormal b1193Tg + MO1-dlx3b + MO2-foxi1(AB) heat shock Fig. 7 with image from Hans et al., 2007
OTHER MO1-dlx3b MORPHOLINO PAGESNo links to external sites
CITATIONS (11)