ZFIN ID: ZDB-CRISPR-190220-1
CRISPR Name: CRISPR1-bud13
Target: bud13 (1)
Source:
Target Sequence:
5' - GGAGAGCGTGTCCTCCGTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-bud13 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-bud13
Genomic Feature Affected Genomic Regions    
ya103 bud13    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-bud13 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-bud13
No data available

Phenotype of all Fish created by or utilizing CRISPR1-bud13
No data available
OTHER CRISPR1-bud13 CRISPR PAGESNo links to external sites
CITATIONS (2)