header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-170216-1
CRISPR Name: CRISPR1-nr3c1
Target: nr3c1 (1)
Source:
Target Sequence:
5' - ACAGCTGTCGTCGGTCTGCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-nr3c1 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-nr3c1
Genomic Feature Affected Genomic Regions    
ia30 nr3c1    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-nr3c1 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-nr3c1
No data available

Phenotype of all Fish created by or utilizing CRISPR1-nr3c1
Phenotype Fish Conditions Figures
whole organism crhb expression increased amount, abnormal nr3c1ia30/ia30 standard conditions Fig. 4 from Facchinello et al., 2017
heart structure, abnormal nr3c1ia30/ia30 standard conditions Fig. 2 with image from Facchinello et al., 2017
whole organism pomca expression increased amount, abnormal nr3c1ia30/ia30 mechanical stress Fig. 4 from Facchinello et al., 2017
whole organism nr3c1 expression decreased amount, abnormal nr3c1ia30/ia30 standard conditions Fig. S1 with image from Facchinello et al., 2017
intestinal bulb epithelium decreased thickness, abnormal nr3c1ia30/ia30 standard conditions Fig. 2 with image from Facchinello et al., 2017
whole organism viability, abnormal nr3c1ia30/ia30 standard conditions Fig. 1 from Facchinello et al., 2017
whole organism fkbp5 expression decreased amount, abnormal nr3c1ia30/ia30 mechanical stress Fig. 4 from Facchinello et al., 2017
whole organism star expression increased amount, abnormal nr3c1ia30/ia30 standard conditions Fig. 5 from Facchinello et al., 2017
whole organism fkbp5 expression decreased amount, abnormal nr3c1ia30/ia30 standard conditions Fig. 4 from Facchinello et al., 2017
whole organism cortisol increased amount, abnormal nr3c1ia30/ia30 standard conditions Fig. 4 from Facchinello et al., 2017
whole organism cortisol increased amount, abnormal nr3c1ia30/ia30 standard conditions Fig. 4 from Facchinello et al., 2017
whole organism crhb expression increased amount, abnormal nr3c1ia30/ia30 mechanical stress Fig. 4 from Facchinello et al., 2017
subcutaneous fat increased amount, abnormal nr3c1ia30/ia30 standard conditions Fig. 2 with image from Facchinello et al., 2017
whole organism pomca expression increased amount, abnormal nr3c1ia30/ia30 standard conditions Fig. 4 from Facchinello et al., 2017
trabecular layer of ventricle decreased object quality, abnormal nr3c1ia30/ia30 standard conditions Fig. 2 with image from Facchinello et al., 2017
whole organism hsd11b2 expression decreased amount, abnormal nr3c1ia30/ia30 standard conditions Fig. 5 from Facchinello et al., 2017
whole organism cortisol increased amount, abnormal nr3c1ia30/ia30 mechanical stress Fig. 4 from Facchinello et al., 2017
pancreas decreased size, abnormal nr3c1ia30/ia30 standard conditions Fig. 2 with image from Facchinello et al., 2017
whole organism cortisol increased amount, abnormal nr3c1ia30/ia30 mechanical stress Fig. 4 from Facchinello et al., 2017
whole organism foxo3b expression decreased amount, abnormal ia20Tg ; nr3c1ia30/ia30 control Fig. 3 with image from Facchinello et al., 2017
anatomical structure EGFP expression decreased amount, abnormal ia20Tg ; nr3c1ia30/ia30 control Fig. 3 with image from Facchinello et al., 2017
anatomical structure EGFP expression decreased amount, abnormal ia20Tg ; nr3c1ia30/ia30 control Fig. 3 with image from Facchinello et al., 2017
whole organism fkbp5 expression decreased amount, abnormal ia20Tg ; nr3c1ia30/ia30 control Fig. 3 with image from Facchinello et al., 2017
anatomical structure EGFP expression decreased amount, abnormal ia20Tg ; nr3c1ia30/ia30 chemical treatment: dexamethasone Fig. 3 with image from Facchinello et al., 2017
anatomical structure EGFP expression decreased amount, abnormal ia20Tg ; nr3c1ia30/ia30 chemical treatment: dexamethasone Fig. 3 with image from Facchinello et al., 2017
whole organism fkbp5 expression decreased amount, abnormal ia20Tg ; nr3c1ia30/ia30 chemical treatment: dexamethasone Fig. 3 with image from Facchinello et al., 2017
whole organism foxo3b expression decreased amount, abnormal ia20Tg ; nr3c1ia30/ia30 chemical treatment: dexamethasone Fig. 3 with image from Facchinello et al., 2017
whole organism EGFP expression amount, ameliorated ia21Tg ; nr3c1ia30/ia30 chemical treatment: dexamethasone Fig. S3 with image from Vettori et al., 2017
OTHER CRISPR1-nr3c1 CRISPR PAGESNo links to external sites
CITATIONS (3)