Genomic Feature

ta98

ID
ZDB-ALT-980203-1630
Name
ta98
Synonyms
  • A98A (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Point Mutation
Variant Location
Chr 4: 8662547 (GRCz11) (1) Details
Nucleotide change
T/C
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>C at position 968 (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Cys>Arg at position 323 (1)
Sequences
Flanking Sequence
GCTTGCTTTTTACAACTACACCATCAGTATATTTCACCAGTCATATAAAAACTCACTCTGGACAATGAAAGTTTTAGTGCATGTTTGGAATCCCTGTTATGTGTGTATTCTTTGGTTCACTGCTCATTGAAATAACTACCCTCAATCTCTCTCCCTCTCTCTTAAAGGCGGTGTATAATCTAGCGAATGTGGCCTGCAAGTGTCATGGCGTCTCAGGCTCGTGCAGCTTGAAAACCTGCTGGCTCCAGCTGGCCGACTTCCGGCGTGTTGGAGAATTCCTGAAGGAGAAATACGACAGCGCCGCCGCCATGCGCATTAACCGACGTGGAAAACTAGAGCTGGTCAATAATCGATTCAACCCACCGACAGGTGAAGATCTGGTCTACATCGACCCCAGCCCGGATTACTGCCTGCGCAATGAAACCACTGGGTCTCTGGGCACCCAAGGCCGCCTATGCAACAAGACCTCGGAGGGTATGGACGGCTGCGAGCTCATGTGC
T/C GCGGCCGCGGGTACGACCAGTTCAAGACCTACAAACATGAGCGCTGCCACTGCAAGTTCCACTGGTGCTGCTATGTCAAGTGCAAACGCTGCACGTCACTCGTAGACCAGTTTGTGTGCAAGTAGCAGACGTGAGAACTGGGGGACAGACGCACTGAGCAATTAAGCAGGAGAAGAAACGGGACCCTTAACGGACCCAGAGGGGCAACTTAGAGATAATTAAATGTAAAAATGATATATTAAATAGCAACAAATTAAAATAAGTATATAAATAAGTGTACGTGTGCCGTTGATAGTAATTTAATGACCTGAGGATCCACGTTGGACGTCATTGATGAAAAAGGAGGCACCGGTGTGATGCATTCCGGCTCAAGCTGTGTTTCTCTCATAAAGAGAGGAAGGAACTCTTGACTTGTGCTACAAGAAACTCTTTAGAGACTCGAGGAAAAGGCGCAGAAATAGGATGGGGAACATCAAGGGCGCATCACCCACCCATTGCCT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations