Genomic Feature

tw2

ID
ZDB-ALT-980203-1453
Name
tw2
Synonyms
  • W02B (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Note
An A1126T substitution results in a stop codon (K376Stop) truncating the protein just N-terminal to the activation domain. Same change is found in the tw11 allele.
An A1126T substitution results in a stop codon (K376Stop) truncating the protein just N-terminal to the activation domain. Same change is found in the tw11 allele.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 3: 1499549 (GRCz11) (1) Details
Nucleotide change
A/T
Variant Notes
An A1126T substitution results in a stop codon (K376Stop) truncating the  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
A>T at position 1126 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Lys>Stop at position 376 (1)
Sequences
Flanking Sequence
CTATTTTTGAGTAAACAACAACTACTTTTGAAAAACGAAAAACCAACTAAAACTATTTTCTTGTATTTGTTTGCTCAGGTCAGAGTCACAGCCCTCCAACGCCCCCTACCACCCCCAAGACGGAACTGCAGGGAGGAAAATCAGGCGAGGGCAAGCGTGAGGGCGGAGCCTCTCGGAGTGGACTGGGGGTGGGAGCAGATGGAAGCTCCGCCTCATCGTCTGCCAGCGGGAAACCGCACATCGACTTCGGTAACGTGGACATTGGCGAAATCAGCCATGACGTGATGGCCAACATGGAGCCGTTCGACGTGAACGAGTTCGACCAGTATCTCCCACCCAATGGCCACCCGCAGGCGTCCGCCACTGCCAGCGCAGGATCTGCAGCGCCATCGTATACATACGGCATCTCCAGCGCGCTAGCGGCCGCTAGTGGCCACTCCACCGCATGGCTGTCCAAGCAGCAACTGCCGTCCCAGCAGCATTTGGGCGCAGATGGCGGG
A/T AAACGCAGATAAAGAGTGAAACACACTTCCCTGGGGATACAGCGGCGAGCGGTTCACACGTCACATACACGCCGCTAACACTGCCGCACTACAGCTCCGCCTTCCCCTCGCTGGCGTCCCGCGCACAATTCGCCGAATACGCCGAGCACCAGGCCTCGGGATCCTACTACGCCCACTCCAGCCAGACCTCAGGCCTCTACTCCGCCTTCTCCTACATGGGCCCCTCACAGCGGCCCCTGTACACCGCCATTCCGGATCCGGGATCCGTGCCGCAGTCACACAGCCCTACGCATTGGGAGCAGCCCGTATACACCACACTGTCTCGACCGTGACACACTCTACCAAGATGACCAGTCACTAAAGGTCCAACCGTAAGGTGTGTGTGTGTGTGTGCTAAAAATCATCGAAACACTCGCCTGCACCACAATCGACACAAACTGAGATCTGAGAAAAGAGTGTGTGTGTGTGTGGAGATCTGCAGGGAAATATTCTCACGTGCC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations