ZFIN ID: ZDB-ALT-980203-1162
Genomic Feature: tm154
Synonyms: M154A (1)
Affected Genomic Regions: cacna1ab
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Nüsslein-Volhard Lab
Location: Chr 11: 30906742 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>G (1)
Transcript Consequence: Missense (1)
Protein Consequence: Amino Acid Substitution: Leu>Val at position 356 (1)
FLANKING SEQUENCE (GENOMIC)
TGTTTGCCATTATTGGCCTGGAGTTCTACATGGGCAAATTCCACACCACCTGCTTCAACACCATCACTGGTGAGCTTTTCTCAAAGAGAGAAGACAAAAAAAACATGTTGTAGTAGTTTTACCTAACCATGAAACTTTATGTTGACCAGGTGAGATGTATGATGAACGGCCATGTGGAGCTCGGACATGTGATGCAAACAATACGCAATGCCAGGGCTACTGGCTTGGGCCCAACTATGGGATCACACAGTTCGACAATGTACTTTTTGCTGTGCTCACTGTATTCCAGTGCATCACAATGGAGGGCTGGACTGATATGCTTTATTATGTAAGACTTAAAGGCAATAGTTTAACACATATTCATCTTTTTAGGTTTAAGGTAATAATGTTTGGTAAATGTGTGCGTATCACAGAGCAATGATGCCTTAGGGAGTGCCTGGAACTGGATGTACTATGTTCCGCTCATCATTATTGGATCCTTCTTCATGCTTAATCTGGTG
T/G
TGGGTGTTCTCTCAGGGTAAGATCTATCTGTTTATCTGTTTCCAGCTGCCAACAAATAAATATTAATAATTATACAAATGAAAGGAAAAAAATATTATACACTCAGTGGCCACTTTATTAGGTACACCTTACTAGTACTAGGTTGGACCTCTTTTGCCTTCAGAACTGCCTTAATTCTTCATGGCATAGATTCTACAAGGTACTGGAAATATTCAAAGATGAAGCTATCTTCCATATTGACATGATAGCATAACGCAGTTGCTGCAGATTTGTCGGCTGCACATACATGATGGGAATCTTGATGGGAAAGTGTTCCACCACATCCCAAAGGTGATCTATTGGATTAAGATATGGTGACTTTGGAGGCCATTTAAGTACAGTGAACTCATAATCATGTTCATGAAACCAGTCTGAGATGATTCACGCTTTATGACATGGCGCGTTGTTCTGCTGGAAGTAACCATCAGAAGATGCGTACACTGGGGTCATAAAGGAATGGA
(1)
NOTES
Comment Citation
Thymine-to-guanine nucleotide substitution, resulting in a leucine-to-valine  ... ZFIN Staff
OTHER tm154 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous cacna1abtm154/tm154 cacna1ab ♀+/- ♂+/-
Heterozygous cacna1abtm154/+ cacna1ab ♀+/- ♂+/-
cacna1abtm154/+ (AB) cacna1ab Unknown
Unknown cacna1abtm154 cacna1ab Unknown

CITATIONS  (9)