ZFIN ID: ZDB-ALT-980203-1099
Genomic Feature: tc257z
Synonyms: AC057Z (1)
Affected Genomic Regions: slc17a6b
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Nüsslein-Volhard Lab
Location: Chr 7: 32828534 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
MUTATION DETAILS No data available
FLANKING SEQUENCE (GENOMIC)
TAATAATACACATTGTTGACATAATCGTGGTAATTACAAAACACATAGTGCCTCTACAAATCAATACACTTGTCCCGAAGACAAAGCCTGGGTTATTGTTCTCTTACAGATATCCTCAGGTCATAACTGATTGTTATAGGATAATGGACTTTTCCCAGTATGAACAACCACAAATGTTTTTTTTTCTTGGAGAAATAGCCAAAAGTGCTCATGTTTTAGATATGAATAGGCCTATAATTGTCATGGTGTTAGATTAATATTACACAGTTAAGAAATAAAGTTTTGCAGCAGTTTAGCAGTTTAATTGGTTCCGCGAAAAACTTTTCAGTCAATTGTTCTTAAAAGAACATTTTTTTCTAAATATTACGATTTTAAGAAAGCCTTCGTGGAATGGAAAGGCTCCATGAATGTTAAATGTTCTTTGTGGAATCATTCATGCCAATACAGACTCTTTTTAAAGAGCACAGCAAACAAACAGCGAGAAAACCGTAGGTATTCTT
A/T
CCTCTACAAGCCCTTGTAATATCCTGACGAATATGACGCAACCATAGTGACCACGTGCAGCTGAGGGGATGAACATATTCAGTGTGGACGTGAGGAGAATCGCCGCGCCAAAAACCCTGCATAGTAAATGGATACGTGGTTAAATTGTGCTGTTTAGTTAGAGAAACACATTTATAGGTTCATTTCATCAGTTTTCCCCTATAAACCTATACTATTCAGGTGTCATTATAGTCGCCAATCTTTTTAATTATACACAGTTTTGTCGCTGAGAGAAAATAGGCTGCTAAACATACACGTGTTTGTCATAAAAAAAATGGTAGCCTATTGTGTTTGGTCACGCGGGGTAGGCTTCTAGTAGGCTATTACCACAGAAGAAAAACGGACTTTCATTTATTTCCAATTTTTCTGTCGTCGTGTAGAGCTCGAGACCCCTCACCTCTCTCTCCCACTGGCACAGCGCTAATCGGATTGAGAGAGTCCTCCAGCACGAGACTCGCTGA
OTHER tc257z PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous slc17a6btc257z/tc257z slc17a6b ♀+/- ♂+/-

CITATIONS  (10)