ZFIN ID: ZDB-ALT-980203-1080
Genomic Feature: ti274
Synonyms: AI74A (1)
Affected Genomic Regions: dbt
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Nüsslein-Volhard Lab
Location: Chr 22: 16302537 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>A in Donor Splice Site (1)
Transcript Consequence: Intron Gain of Intron 6 (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
CTCCTATTGGTCAACATCACGCACATCAGACCTGTTGGCCTCTCAGTGAGGAACTACATTTGAAATAAGTGTATATTAATAGGGTGAGTGCCTGCCTGTCAAAACAGCAGCTGTGTTTTAGTGTAACAAGACATACACATACAGGGGACTAATATTAGCAGTATTTATCCTTTTTCAGTCTTGTTGATATGTAATGCAAGTTGTTGTATGTACTCAAAAATGCTCCATTTGCATCAATGTCTTTTCCTTACAGATCAAACTAAGCGAAGTTGTCGGCACTGGAAAAGATGGACGCATTCTCAAAGAAGACATCTTGAACTTCATCGCCAAACAAACTGGGGCCATTTTACCTCCAGCACCCTTCCAGGAGATTCGTCCTCCACCTCCTGCGGCTGCAGCACCTTTAACTCCATCTGCAAAGGCAACTCCACCGAGTGTACCTATTCCTGTGATCCCTAAACCTGTGTTTACGGGCAAAGACCACACTGAACCTATTAAAG
G/A
TTTGTTTGCTGGCCTGTTTTGATTTGTAACTCGGTTCATTTACTGAATTGACAAACATGTTCATTTACAAATTTGTTTGACGAAGGCTTTCAGAAGGCGATGGTTAAGACCATGTCAGCAGCACTGAAGATCCCTCACTTCGGCTATAAAGATGAAGTAGATCTGAGCCAGTTGGTCCGGTTGCGCTCTGAACTCAAAGGTCTGACTGAATCACGAGGAGTGAAGCTCAGCTACATGCCCTTCTTCATCAAGGTACAAAAGAAAGCAATTTGTTGTGGGAAAAACCCTTGATCATGCTTTCTCTTGATATCGGTATCTTCTTTGTAAACAGGCAGCGTCACTCGCCCTTCTCCATTTTCCCATTCTCAACTCGTCTTTGGATGAAAACTGCACAAGTATCACCTATAAGGTAAGGTTTTTTTTCCAGGTTAAGATCAGTTGGACTCAGACATGGTAGATCATTGACCATCGGTCTTCTCCAGGCTGCTCATAATATCGGA
(1)
Comment Citation
The 86 bp retained intron in this mutant alters the sequence downstream of  ... Friedrich et al., 2012
OTHER ti274 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous dbtti274/ti274 dbt ♀+/- ♂+/-

CITATIONS  (7)