ZFIN ID: ZDB-ALT-190805-4
Genomic Feature: t26171
Synonyms:
Affected Genomic Regions: tmie (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Nüsslein-Volhard Lab
Location: Chr 2: 2279029 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: A>G (1)
FLANKING SEQUENCE (GENOMIC)
TTAGTTAATTAGGTTAACTAGGCAGGGTAATTAGACAAGTTATTATATGATGATGGTTTGCTCTGTAGACTATCAAAAACAAATATAGCTTAAAGGGGCTAATAATATTGTCCTTAAAATGCTGTTTAAAAAATTAATAACTGCTTTTATTCAAGCCGAAATAAAACAAATAAGACTTTCTCCAGAAAAAAAAATATTATCAGACATACTGTGAACATTTCCTGAATCTGTTCAACATCATTTGGGAAATATTTAAAAAAGAAAAAAAATTCATAGGGGAGCTAATAATTCTGACTTCAACTGACTTCAATTTTATATTGCAGCCTCCTGCGATTGGCTAATTTCAACGTTTCAAATTGCGATTTAATTTCGATTATTAGCACAGCCCTAATGGATACAGTACAATAGATATTTTTCCTAAATCATCATTTTTTTAAAAGTTGTGCAAAAGTTTGTCATAAACTTTTAATAACTGCTCAATCCTTTTTCTTTTTTGGTTT
A/G
GCGGCAAAGGTTGAGGTGAAGGAGGAGGTGCCAACCGTCGCAGGAAAGGTGGACGGAGAAAAGGAGAAAAAGAAGAAAGAAAAAGAGAGCAAAAAGGAAGGCAAAGGTGCAAAAGAAGGTAAAGAAGAGGAGAAAGAGGAACCCGCAAAAAAGAAAGGAGAAAAGGGAGAAAAAGGGGAGAAAGGAGCACCAAAGAAAGAAGCATCAGACGGAGGGAAAGGTAAAAAAGGAGGAGAAAAAGCAGAGGAGAAAGGAGGTGCCAAGAAGCCTGCGAAGAAATGAACACTCACACACACCTCAGGGGTGTCTCCGCGCAACTTTCATCCGCCATTTTTTATTTTTTGTAAGAAAATTTATAAATGTACATTTACAGAATATTTTATTTGTAAATAGCAAACGGTGACAATAAATGATTCTCTTAATTATACACGTTCATTCATTTCTTATGATACACATGATCAGCACTAAATAATACAACACTGCTGCACGGTTCGGTTTCA
(1)
OTHER t26171 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous tmiet26171/t26171 (TU) tmie ♀+/- ♂+/-

CITATIONS  (1)