header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-190719-1
Genomic Feature: ka701
Synonyms:
Affected Genomic Regions: sox1a (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-sox1a
Lab Of Origin: Strähle Lab
Location: Chr 9: 21723127 - 21723133 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 7 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
TAGAGGGGGCGGTGTTGACCCTTCGTGCACCCCGCCTACTAGTTCTTTCCTCGTTGTCTACGTCACTCGACCGAACTCCATGCAAATCGCTCCTCACTGGAACGCCATTGGCCGCTCGCTCATTTTAATCGCTGTCAAAACGCATCATATGGCCGCCGCTTTAACTAACTCTTCAACTCCACTAGGAAAAGTAACTCAAATGCACGTTCAATTAATGTGGATGTGAAGCGGCAGTCGGAGACGACACTAAACTGGCTACAGGAGCGAAAAGAGAGCCCGAAATTGTCAGCAAACGGTTGGGAATAAGCTGAATTCCACACTTCATCGGAGCTCCACTGGCTCGTGAAGCACCTGTTTCAAGCGGACTACGGAGCGCCGAAAGTTCATGCTTTTTCTCTGCTAGTTGAGAACTTTTAAGCCACTTGAATGTATAGCATGATGATGGAAACGGACCTTCATTCCCCGGGACCCCAAACCAACACGAACCCGGGGCAAACGGG
TCCAAAT/-
TCGGGGAGCAAAGCCAATCAAGACCGCGTAAAGAGACCCATGAACGCGTTTATGGTCTGGTCTCGGGGCCAGCGCCGAAAAATGGCACAGGAGAACCCCAAAATGCACAACTCTGAAATTAGCAAAAGACTCGGTGCTGAGTGGAAGGTGATGTCAGAGGCTGAAAAGCGGCCCTTTATTGATGAGGCGAAGCGGTTGCGAGCCATGCACATGAAAGAGCATCCGGATTACAAATACAGACCGAGGCGCAAAACCAAGACCCTGCTTAAAAAGGACAAGTACTCGTTGGCGGGTGGCTTGCTCGGCGGTGCGGGTGGTGGAGTCGGGATGAGTCCTGCGGGGGTCGGCCAGAGGTTGGAGAGTCCTGGGGGTCACGGAGGCTCGGCCAGCGCTGGCTACGCGCACATGAACGGCTGGGCGAACGGCACTTACTCCGGCCAGGTGGCTGCCGCGGCGGCGGCCGCCGCGATGATGCAGGAGGCGCAGCTCGCTTACAGCCA
OTHER ka701 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (1)