header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-190718-8
CRISPR Name: CRISPR1-sox1a
Target: sox1a (1)
Source:
Target Sequence:
5' - GGGGCAAACGGGTCCAAATT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-sox1a No data available
GENOMIC FEATURES CREATED WITH CRISPR1-sox1a
Genomic Feature Affected Genomic Regions    
ka701 sox1a    
ka705Tg sox1a    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-sox1a No data available
PHENOTYPE
Phenotype resulting from CRISPR1-sox1a
No data available

Phenotype of all Fish created by or utilizing CRISPR1-sox1a
No data available
Genome Resources:
CITATIONS (1)