header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-SSLP-980528-940

Mapping Details

SSLP: z7809
PHYSICAL MAP AND BROWSERNo data available
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
21 38.1cM z7809 Boston MGH Cross (MGH) Fishman, Mark C. Data
21 153.22cR Z7809 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
21 2056.0cR z7809 Goodfellow T51 (T51) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
z7609 SSLP 21 Auer et al., 2007 Auer RL et al (Br. J Hematol. 137, 443-453) mapped the zebrafish orthologs and  ...
dixdc1b GENE 21 Auer et al., 2007 Auer RL et al (Br. J Hematol. 137, 443-453) mapped the zebrafish orthologs and  ...
ddx10 GENE 21 Auer et al., 2007 Auer RL et al (Br. J Hematol. 137, 443-453) mapped the zebrafish orthologs and  ...
dlat GENE 21 Auer et al., 2007 Auer RL et al (Br. J Hematol. 137, 443-453) mapped the zebrafish orthologs and  ...
ncam1a GENE 21 2.02cR Auer et al., 2007 Auer RL et al (Br. J Hematol. 137, 443-453) mapped the zebrafish orthologs and  ...
z10432 SSLP 21 Kok et al., 2007 Kok et al. (2007) show that SBU2 maps to linkage group 21 between Z7809 and  ...
sbu2 Feature 21 Kok et al., 2007 Kok et al. (2007) show that SBU2 maps to linkage group 21 between Z7809 and  ...
birc2 GENE 21 Santoro et al., 2007 Santoro et al (2007) mapped the birc2 locus to LG 21 near marker z7809, on BAC  ...

OTHER MAPPING INFORMATION
Chr 21 Kok et al., 2007 Kok et al. (2007) show that SBU2 maps to linkage group 21 between Z7809 and Z10432
Chr 21 Santoro et al., 2007 Santoro et al (2007) mapped the birc2 locus to LG 21 near marker z7809, on BAC clone DKEYP-69C1.
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
IND 276,0,216 60.0
Forward Primer GCCCTCCATTTGCAGTTCTA
Reverse Primer ACAGATGGTGAGAGCGTGTG
AB 254,0,282 60.0
Forward Primer GCCCTCCATTTGCAGTTCTA
Reverse Primer ACAGATGGTGAGAGCGTGTG
EKW 226,0,254 60.0
Forward Primer GCCCTCCATTTGCAGTTCTA
Reverse Primer ACAGATGGTGAGAGCGTGTG
TU 0,282 60.0
Forward Primer GCCCTCCATTTGCAGTTCTA
Reverse Primer ACAGATGGTGAGAGCGTGTG