| ZFIN ID: ZDB-SSLP-980528-1967 |
| SSLP: | z22094 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 14 | 49.8 cM | z22094 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 14 | 494.21 cR | Z22094 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 14 | 2946.0 cR | z22094 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z26376 | SSLP | 14 | 4.4 cM | Demarest et al., 2011 | unm_t31103 was mapped to Chr. 14 by Demarest B.L. et al. (2011, Genetics 187(1):333-336) using SSLP markers and EP technique. |
| z65389 | SSLP | 14 | Demarest et al., 2011 | unm_t31103 was mapped to Chr. 14 by Demarest B.L. et al. (2011, Genetics 187(1):333-336) using SSLP markers and EP technique. | |
| wdr1 | GENE | 14 | Demarest et al., 2011 | unm_t31103 was mapped to Chr. 14 by Demarest B.L. et al. (2011, Genetics 187(1):333-336) using SSLP markers and EP technique. | |
| z22128 | SSLP | 14 | Hong et al., 2005 | Hong et al. (2005, Proc. Natl. Acad. Sci. USA 102(51):18473-18478) mapped med12 to LG14. | |
| z7495 | SSLP | 14 | Hong et al., 2005 | Hong et al. (2005, Proc. Natl. Acad. Sci. USA 102(51):18473-18478) mapped med12 to LG14. | |
| z34510 | SSLP | 14 | Hong et al., 2005 | Hong et al. (2005, Proc. Natl. Acad. Sci. USA 102(51):18473-18478) mapped med12 to LG14. | |
| med12 | GENE | 14 | Hong et al., 2005 | Hong et al. (2005, Proc. Natl. Acad. Sci. USA 102(51):18473-18478) mapped med12 to LG14. | |
| slit3 | GENE | 14 | Hong et al., 2005 | Hong et al. (2005, Proc. Natl. Acad. Sci. USA 102(51):18473-18478) mapped med12 to LG14. | |
| z9017 | SSLP | 14 | Ziv et al., 2013 | ||
| s357 | Feature | 14 | 0.16 cM | Ziv et al., 2013 |
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| AB | 185,181,0,183 | 60.0 | |
| Forward Primer | GCAAACTGAGGCTGAGCTCT | ||
| Reverse Primer | AAGCCGTCCATCTTGGTATG | ||
| IND | 0,191,177 | 60.0 | |
| Forward Primer | GCAAACTGAGGCTGAGCTCT | ||
| Reverse Primer | AAGCCGTCCATCTTGGTATG | ||
| TU | 181,209,183 | 60.0 | |
| Forward Primer | GCAAACTGAGGCTGAGCTCT | ||
| Reverse Primer | AAGCCGTCCATCTTGGTATG | ||
| EKW | 209,181 | 60.0 | |
| Forward Primer | GCAAACTGAGGCTGAGCTCT | ||
| Reverse Primer | AAGCCGTCCATCTTGGTATG |