Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
7	40.2 cM	z11119	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
7	122.6 cR	Z11119	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
7	2858.0 cR	z11119	Goodfellow T51 (T51)	Geisler, Robert	Data
7	68.4 cM	z11119	Heat Shock (HS)	Woods, Ian G.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
z8693	SSLP	7		Begemann et al., 2001	Begemann, et al. (2001. Dev 128:3081-3094.) report aldh1a2 corresponds to an  ... Begemann, et al. (2001. Dev 128:3081-3094.) report aldh1a2 corresponds to an EST (fb50h01) mapped between z11119 and z8693 on the LN54 mapping panel.
i26	Feature	7		Begemann et al., 2001	Begemann, et al. (2001. Dev 128:3081-3094.) used bulk segregant analysis to  ... Begemann, et al. (2001. Dev 128:3081-3094.) used bulk segregant analysis to demonstrate the nls mutant corresponds to a gene represented by an EST (fb50h01) mapped between z11119 and z8693 on the LN54 mapping panel.
fb50h01	EST	7		Begemann et al., 2001	Begemann, et al. (2001. Dev 128:3081-3094.) used bulk segregant analysis to  ... Begemann, et al. (2001. Dev 128:3081-3094.) used bulk segregant analysis to demonstrate the nls mutant corresponds to a gene represented by an EST (fb50h01) mapped between z11119 and z8693 on the LN54 mapping panel.
z8693	SSLP	7		Begemann et al., 2001	Begemann, et al. (2001. Dev 128:3081-3094.) used bulk segregant analysis to  ... Begemann, et al. (2001. Dev 128:3081-3094.) used bulk segregant analysis to demonstrate the nls mutant corresponds to a gene represented by an EST (fb50h01) mapped between z11119 and z8693 on the LN54 mapping panel.
aldh1a2	GENE	7		Begemann et al., 2001	Begemann, et al. (2001. Dev 128:3081-3094.) report aldh1a2 corresponds to an  ... Begemann, et al. (2001. Dev 128:3081-3094.) report aldh1a2 corresponds to an EST (fb50h01) mapped between z11119 and z8693 on the LN54 mapping panel.
z20853	SSLP	7		Farber et al., 2003	Farber et al. (Genome Res 13, 1082-1096, 2003) mapped the anxa2b gene to LG7  ... Farber et al. (Genome Res 13, 1082-1096, 2003) mapped the anxa2b gene to LG7 between Z20853 and Z11119 on the LN54 radiation hybrid panel.
anxa2b	GENE	7		Farber et al., 2003	Farber et al. (Genome Res 13, 1082-1096, 2003) mapped the anxa2b gene to LG7  ... Farber et al. (Genome Res 13, 1082-1096, 2003) mapped the anxa2b gene to LG7 between Z20853 and Z11119 on the LN54 radiation hybrid panel.
scube2	GENE	7		Hollway et al., 2006	Marker z11119 was found to be non-recombinant in 1400 meioses. Marker z11119 was found to be non-recombinant in 1400 meioses.
z24045	SSLP	7		Kawakami et al., 2005	... Kawakami+A+et+al+mapped+the+you+mutation+between+z11119+and+z24045+on+LG+7%2e+This+critical+region+was+then+narrowed+to+be+between+wu%3afc11b09+and+wu%3afc49b10%2e+Sequencing+BAC+and+PAC+clones+in+the+region+and+subsequent+sequence+analyses+identified+the+scube2%2c+slc7a6%2c+st5%2c+zgc%3a103493+and+wu%3afc49b10+genes%2e+Nonsense+mutations+were+then+identified+in+the+scube2+gene+in+all+three+alleles+of+you+mutants%2e
adgrg1	GENE	7		Kawakami et al., 2005	... Kawakami+A+et+al+mapped+the+you+mutation+between+z11119+and+z24045+on+LG+7%2e+This+critical+region+was+then+narrowed+to+be+between+wu%3afc11b09+and+wu%3afc49b10%2e+Sequencing+BAC+and+PAC+clones+in+the+region+and+subsequent+sequence+analyses+identified+the+scube2%2c+slc7a6%2c+st5%2c+zgc%3a103493+and+wu%3afc49b10+genes%2e+Nonsense+mutations+were+then+identified+in+the+scube2+gene+in+all+three+alleles+of+you+mutants%2e
scube2	GENE	7		Kawakami et al., 2005	... Kawakami+A+et+al+mapped+the+you+mutation+between+z11119+and+z24045+on+LG+7%2e+This+critical+region+was+then+narrowed+to+be+between+wu%3afc11b09+and+wu%3afc49b10%2e+Sequencing+BAC+and+PAC+clones+in+the+region+and+subsequent+sequence+analyses+identified+the+scube2%2c+slc7a6%2c+st5%2c+zgc%3a103493+and+wu%3afc49b10+genes%2e+Nonsense+mutations+were+then+identified+in+the+scube2+gene+in+all+three+alleles+of+you+mutants%2e
slc7a6	GENE	7		Kawakami et al., 2005	... Kawakami+A+et+al+mapped+the+you+mutation+between+z11119+and+z24045+on+LG+7%2e+This+critical+region+was+then+narrowed+to+be+between+wu%3afc11b09+and+wu%3afc49b10%2e+Sequencing+BAC+and+PAC+clones+in+the+region+and+subsequent+sequence+analyses+identified+the+scube2%2c+slc7a6%2c+st5%2c+zgc%3a103493+and+wu%3afc49b10+genes%2e+Nonsense+mutations+were+then+identified+in+the+scube2+gene+in+all+three+alleles+of+you+mutants%2e
slc7a6os	GENE	7		Kawakami et al., 2005	... Kawakami+A+et+al+mapped+the+you+mutation+between+z11119+and+z24045+on+LG+7%2e+This+critical+region+was+then+narrowed+to+be+between+wu%3afc11b09+and+wu%3afc49b10%2e+Sequencing+BAC+and+PAC+clones+in+the+region+and+subsequent+sequence+analyses+identified+the+scube2%2c+slc7a6%2c+st5%2c+zgc%3a103493+and+wu%3afc49b10+genes%2e+Nonsense+mutations+were+then+identified+in+the+scube2+gene+in+all+three+alleles+of+you+mutants%2e
dennd2b	GENE	7		Kawakami et al., 2005	... Kawakami+A+et+al+mapped+the+you+mutation+between+z11119+and+z24045+on+LG+7%2e+This+critical+region+was+then+narrowed+to+be+between+wu%3afc11b09+and+wu%3afc49b10%2e+Sequencing+BAC+and+PAC+clones+in+the+region+and+subsequent+sequence+analyses+identified+the+scube2%2c+slc7a6%2c+st5%2c+zgc%3a103493+and+wu%3afc49b10+genes%2e+Nonsense+mutations+were+then+identified+in+the+scube2+gene+in+all+three+alleles+of+you+mutants%2e
anxa2b	GENE	7		Smart et al., 2004	Smart EJ et al (Proc. Natl. Acad. Sci USA 101, 3450-3455) mapped the anx2b  ... Smart EJ et al (Proc. Natl. Acad. Sci USA 101, 3450-3455) mapped the anx2b gene to LG7 between z20853 and z11119 on the LN54 radiation hybrid panel.
z20853	SSLP	7		Smart et al., 2004	Smart EJ et al (Proc. Natl. Acad. Sci USA 101, 3450-3455) mapped the anx2b  ... Smart EJ et al (Proc. Natl. Acad. Sci USA 101, 3450-3455) mapped the anx2b gene to LG7 between z20853 and z11119 on the LN54 radiation hybrid panel.
fk03a	Feature	7		Sullivan-Brown et al., 2008	Sullivan-Brown, et al. (2008. Dev. Biol. 314:261-275) reports mapping swt to  ... Sullivan-Brown, et al. (2008. Dev. Biol. 314:261-275) reports mapping swt to LG7 between Z11119 and Z15270.
z15270	SSLP	7		Sullivan-Brown et al., 2008	Sullivan-Brown, et al. (2008. Dev. Biol. 314:261-275) reports mapping swt to  ... Sullivan-Brown, et al. (2008. Dev. Biol. 314:261-275) reports mapping swt to LG7 between Z11119 and Z15270.
z15270	SSLP	7		Woods et al., 2005
ty97	Feature	7		Woods et al., 2005

OTHER MAPPING INFORMATION

Chr 7 Begemann et al., 2001 Begemann, et al. (2001. Dev 128:3081-3094.) used bulk segregant analysis to demonstrate the nls  ... Begemann, et al. (2001. Dev 128:3081-3094.) used bulk segregant analysis to demonstrate the nls mutant corresponds to a gene represented by an EST (fb50h01) mapped between z11119 and z8693 on the LN54 mapping panel.   Chr 7 Begemann et al., 2001 Begemann, et al. (2001. Dev 128:3081-3094.) report aldh1a2 corresponds to an EST (fb50h01) mapped  ... Begemann, et al. (2001. Dev 128:3081-3094.) report aldh1a2 corresponds to an EST (fb50h01) mapped between z11119 and z8693 on the LN54 mapping panel.   Chr 7 Farber et al., 2003 Farber et al. (Genome Res 13, 1082-1096, 2003) mapped the anxa2b gene to LG7 between Z20853 and  ... Farber et al. (Genome Res 13, 1082-1096, 2003) mapped the anxa2b gene to LG7 between Z20853 and Z11119 on the LN54 radiation hybrid panel.   Chr 7 Smart et al., 2004 Smart EJ et al (Proc. Natl. Acad. Sci USA 101, 3450-3455) mapped the anx2b gene to LG7 between  ... Smart EJ et al (Proc. Natl. Acad. Sci USA 101, 3450-3455) mapped the anx2b gene to LG7 between z20853 and z11119 on the LN54 radiation hybrid panel.   Chr 7 Kawakami et al., 2005 Kawakami+A+et+al+mapped+the+you+mutation+between+z11119+and+z24045+on+LG+7%2e+This+critical+region+w  ... Kawakami+A+et+al+mapped+the+you+mutation+between+z11119+and+z24045+on+LG+7%2e+This+critical+region+was+then+narrowed+to+be+between+wu%3afc11b09+and+wu%3afc49b10%2e+Sequencing+BAC+and+PAC+clones+in+the+region+and+subsequent+sequence+analyses+identified+the+scube2%2c+slc7a6%2c+st5%2c+zgc%3a103493+and+wu%3afc49b10+genes%2e+Nonsense+mutations+were+then+identified+in+the+scube2+gene+in+all+three+alleles+of+you+mutants%2e   Chr 7 Woods et al., 2005   Chr 7 Hollway et al., 2006 Marker z11119 was found to be non-recombinant in 1400 meioses. Marker z11119 was found to be non-recombinant in 1400 meioses.   Chr 7 Sullivan-Brown et al., 2008 Sullivan-Brown, et al. (2008. Dev. Biol. 314:261-275) reports mapping swt to LG7 between Z11119 and  ... Sullivan-Brown, et al. (2008. Dev. Biol. 314:261-275) reports mapping swt to LG7 between Z11119 and Z15270.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
AB	0,139		60.0
Forward Primer	GAAAGGGCTCGATATTGCTC
Reverse Primer	AAAGGACCTTCGCTTTGTGA
IND	133,0,151		60.0
Forward Primer	GAAAGGGCTCGATATTGCTC
Reverse Primer	AAAGGACCTTCGCTTTGTGA
TU	139,0,179		60.0
Forward Primer	GAAAGGGCTCGATATTGCTC
Reverse Primer	AAAGGACCTTCGCTTTGTGA
EKW	0,149		60.0
Forward Primer	GAAAGGGCTCGATATTGCTC
Reverse Primer	AAAGGACCTTCGCTTTGTGA