ZFIN ID: ZDB-GENE-980526-215

ZFIN ID: ZDB-GENE-980526-215

Mapping Details

Gene Name:	even-skipped homeobox 2
Symbol:	evx2

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	9	2,000,237 - 2,004,642	GRCz12tu
NCBI Map Viewer	9	2,000,237 - 2,004,642	GRCz12tu
Ensembl	9	2,002,701 - 2,007,106	GRCz11
NCBI Map Viewer	9	2,002,701 - 2,007,106	GRCz11
UCSC	9	-	GRCz11
Vega	9	2,001,904 - 2,006,309	GRCv10

Mapped Clones containing evx2
RP71-78H1	Chr: 9 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
sa140	9	2,001,636	GRCz12tu	DIRECT		Sealy et al., 2025
	9	2,004,100	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	9	2,003,303	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	9	1,994,899	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa41335	9	2,001,003	GRCz12tu	DIRECT		Sealy et al., 2025
	9	2,003,467	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	9	2,002,670	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	9	1,994,266	Zv9	DIRECT		Busch-Nentwich et al., 2013
nns72Tg	9		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	9		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	9		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	9		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
sa140	9		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	9		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	9		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	9		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
sa41335	9		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	9		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	9		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	9		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
9	15.7 cM	evx2	Mother of Pearl (MOP)	Postlethwait, John H.	Data
9	208.38 cR	Evx-2	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
9	0.0 cM	evx2	Heat Shock (HS)	Woods, Ian G.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS
Marker	Type	Chr	Publication / Person	Comments
hoxd10a	GENE	9	Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd11a	GENE	9	Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd12a	GENE	9	Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd13a	GENE	9	Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd3a	GENE	9	Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd9a	GENE	9	Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd4a	GENE	9	Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.

Chr 9

Amores et al., 1998

Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, ...

Primer Sets:
Strain	Bandsize	Annealing Temperature [C]
SJD	850	36.0
Forward Primer	AACGACAACACCTCCTCAAC
Reverse Primer	CAGTCTTCCGATCTGCTCTC