Community Action Needed: Please respond to the NIH RFI
ZFIN ID: ZDB-GENE-980526-112

Mapping Details

Gene Name: ISL LIM homeobox 1a
Symbol: isl1a
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN Gbrowse 5 40,728,613 - 40,734,045 GRCz11
Ensembl 5 40,728,613 - 40,734,045 GRCz11
Vega 5 40,128,460 - 40,133,892 GRCv10
NCBI Map Viewer 5 40,728,579 - 40,734,064 GRCz11
UCSC 5 - GRCv10
Mapped Clones containing isl1a
CH211-219F7 Chr: 5 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
rw436 5 40,730,696 GRCz11 Tanaka et al., 2011
sa29 5 40,732,319 GRCz11 de Pater et al., 2009

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
5 108.3 cM islet1 Mother of Pearl (MOP) Postlethwait, John H. Data
5 199.13 cR islet1 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
5 86.5 cM isl1 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Genomic Feature rw436 is an allele of isl1a
Marker Type Chr Distance Publication / Person Comments
z9871 SSLP 5 0.42 cM Tanaka et al., 2011 Tanaka, H. et al. (2011, Dev. Dyn. 240(1):9-22) mapped rw436 to Chr. 5 using SSLP markers.
z6094 SSLP 5 0.84 cM Tanaka et al., 2011 Tanaka, H. et al. (2011, Dev. Dyn. 240(1):9-22) mapped rw436 to Chr. 5 using SSLP markers.
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 1110 MnlI 36.0
Forward Primer AGAGTGACATCGACCAGCCT
Reverse Primer GGCGTTGTTCTTCCATCAGT