ZFIN ID: ZDB-GENE-980526-215

Mapping Details

Gene Name: even-skipped homeobox 2
Symbol: evx2
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 9 2,000,237 - 2,004,642 GRCz12tu
NCBI Map Viewer 9 2,000,237 - 2,004,642 GRCz12tu
Ensembl 9 2,002,701 - 2,007,106 GRCz11
NCBI Map Viewer 9 2,002,701 - 2,007,106 GRCz11
UCSC 9 Based on NM_131232 GRCz11
Vega 9 2,001,904 - 2,006,309 GRCv10
Mapped Clones containing evx2
RP71-78H1 Chr: 9 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source Citations
sa140 9 2,001,636 GRCz12tu DIRECT Sealy et al., 2025
9 2,004,100 GRCz11 DIRECT Busch-Nentwich et al., 2013
9 2,003,303 GRCz10 DIRECT Busch-Nentwich et al., 2013
9 1,994,899 Zv9 DIRECT Busch-Nentwich et al., 2013
sa41335 9 2,001,003 GRCz12tu DIRECT Sealy et al., 2025
9 2,003,467 GRCz11 DIRECT Busch-Nentwich et al., 2013
9 2,002,670 GRCz10 DIRECT Busch-Nentwich et al., 2013
9 1,994,266 Zv9 DIRECT Busch-Nentwich et al., 2013
nns72Tg 9 GRCz11 OTHER_MAPPING ZFIN Curated Data

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
9 15.7 cM evx2 Mother of Pearl (MOP) Postlethwait, John H. Data
9 208.38 cR Evx-2 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
9 0.0 cM evx2 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
hoxd10a GENE 9 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd11a GENE 9 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd12a GENE 9 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd13a GENE 9 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd3a GENE 9 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd9a GENE 9 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd4a GENE 9 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.

OTHER MAPPING INFORMATION
Chr 9 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2,  ...
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 850 36.0
Forward Primer AACGACAACACCTCCTCAAC
Reverse Primer CAGTCTTCCGATCTGCTCTC
Genomic Feature nns72Tg is an allele of evx2