ZFIN ID: ZDB-GENE-980526-389

Mapping Details

Gene Name: growth differentiation factor 3
Symbol: gdf3
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 17 5,350,590 - 5,363,462 GRCz12tu
NCBI Map Viewer 17 5,350,590 - 5,363,462 GRCz12tu
Ensembl 17 4,239,437 - 4,252,221 GRCz11
NCBI Map Viewer 17 4,239,433 - 4,252,228 GRCz11
UCSC 17 - GRCz11
Vega 17 4,081,036 - 4,093,820 GRCv10
Mapped Clones containing gdf3
ZFOS-1139C7 Chr: 17 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
fb20a 17 4,240,106 - 4,240,115 GRCz11 DIRECT Guner-Ataman et al., 2018
pr05 17 4,245,057 - 4,245,076 GRCz11 DIRECT Pelliccia et al., 2017
pr06 17 4,245,057 - 4,245,273 GRCz11 DIRECT Pelliccia et al., 2017
pr11 17 4,245,057 - 4,245,058 GRCz11 DIRECT Pelliccia et al., 2017
sa22982 17 5,356,346 GRCz12tu DIRECT Sealy et al., 2025
17 4,245,179 GRCz11 DIRECT Busch-Nentwich et al., 2013
17 4,086,778 GRCz10 DIRECT Busch-Nentwich et al., 2013
17 4,022,555 Zv9 DIRECT Busch-Nentwich et al., 2013
zy51 17 4,245,239 - 4,245,246 GRCz11 DIRECT Bisgrove et al., 2017
zy52 17 4,245,241 GRCz11 DIRECT Bisgrove et al., 2017
zy53 17 4,245,239 - 4,245,244 GRCz11 DIRECT Bisgrove et al., 2017
a164 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
a165 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
fb20a 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
pr05 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
pr06 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
pr11 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa22982 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
zy51 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
zy52 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
zy53 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
17 14.0 cM dvr1 Mother of Pearl (MOP) Postlethwait, John H. Data
17 103.95 cR dvr1 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
17 705.0 cR dvr1 Goodfellow T51 (T51) Geisler, Robert Data
17 9.9 cM vg1 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 266 TaqI 36.0
Forward Primer GTCCATTCGTTTGATCCTAAA
Reverse Primer CAGCATCTACATGCACATTCT
Genomic Feature zy52 is an allele of gdf3