ZFIN ID: ZDB-GENE-980526-44

Mapping Details

Gene Name: patched 2
Symbol: ptch2
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 2 36,942,105 - 36,966,529 GRCz12tu
NCBI Map Viewer 2 36,942,105 - 36,966,529 GRCz12tu
Ensembl 2 33,969,667 - 33,993,533 GRCz11
NCBI Map Viewer 2 33,969,212 - 33,993,636 GRCz11
UCSC 2 Based on NM_130988 GRCz11
Vega 2 33,986,449 - 34,010,315 GRCv10
Mapped Clones containing ptch2
CH211-226H23 Chr: 2 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source Citations
au1 2 33,983,412 GRCz11 DIRECT Lee et al., 2012
hu1602 2 33,978,923 GRCz11 DIRECT Koudijs et al., 2008
sa19807 2 36,956,599 GRCz12tu DIRECT Sealy et al., 2025
2 33,983,706 GRCz11 DIRECT Busch-Nentwich et al., 2013
2 34,000,488 GRCz10 DIRECT Busch-Nentwich et al., 2013
2 33,701,581 Zv9 DIRECT Busch-Nentwich et al., 2013
sa38340 2 36,951,645 GRCz12tu DIRECT Sealy et al., 2025
2 33,978,752 GRCz11 DIRECT Busch-Nentwich et al., 2013
2 33,995,534 GRCz10 DIRECT Busch-Nentwich et al., 2013
2 33,696,627 Zv9 DIRECT Busch-Nentwich et al., 2013
sa39869 2 36,942,416 GRCz12tu DIRECT Sealy et al., 2025
2 33,969,523 GRCz11 DIRECT Busch-Nentwich et al., 2013
2 33,986,305 GRCz10 DIRECT Busch-Nentwich et al., 2013
2 33,687,398 Zv9 DIRECT Busch-Nentwich et al., 2013
sa44536 2 36,948,163 GRCz12tu DIRECT Sealy et al., 2025
2 33,975,270 GRCz11 DIRECT Busch-Nentwich et al., 2013
2 33,992,052 GRCz10 DIRECT Busch-Nentwich et al., 2013
2 33,693,145 Zv9 DIRECT Busch-Nentwich et al., 2013
la010757Tg 2 33,702,299 - 33,702,309 Zv9 ZFIN_Zv9
la014919Tg 2 33,706,998 - 33,707,008 Zv9 ZFIN_Zv9
la028797Tg 2 33,710,614 - 33,710,624 Zv9 ZFIN_Zv9
au1 2 GRCz11 OTHER_MAPPING ZFIN Curated Data
hu1602 2 GRCz11 OTHER_MAPPING ZFIN Curated Data
la010757Tg 2 GRCz11 OTHER_MAPPING ZFIN Curated Data
la014919Tg 2 GRCz11 OTHER_MAPPING ZFIN Curated Data
la028797Tg 2 GRCz11 OTHER_MAPPING ZFIN Curated Data
tc294z 2 GRCz11 OTHER_MAPPING ZFIN Curated Data

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
2 129.9 cM ptc1 Mother of Pearl (MOP) Postlethwait, John H. Data
2 433.54 cR ptc1 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
2 2851.0 cR ptc1 Goodfellow T51 (T51) Geisler, Robert Data
2 89.7 cM ptc1 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
z8451 SSLP 2 Lee et al., 2008 Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that  ...
z11410 SSLP 2 Lee et al., 2008 Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that  ...
z13521 SSLP 2 Lee et al., 2008 Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that  ...
z7632 SSLP 2 Lee et al., 2008 Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that  ...
atp6v0b GENE 2 Lee et al., 2008 Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that  ...

OTHER MAPPING INFORMATION
Chr 2 Lee et al., 2008 Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that places the blowout  ...
Genomic Feature tc294z is an allele of ptch2
Chr Location Mapped As Panel Mapped By Scoring
2 50.5 cM tc294z Boston MGH Cross (MGH) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 480 36.0
Forward Primer AGCAAGGAGCTACGCTACAC
Reverse Primer GCAGGGGAAAAGCTTATCAA
Genomic Feature sa19807 is an allele of ptch2