Genomic Feature

hu1602

ID
ZDB-ALT-080728-1
Name
hu1602
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Hubrecht Institute
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 2: 33978923 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
generated in the van Eeden lab
Mutation of the splice donor from GT to AT results in the insertion of an 81 bp  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>A in Donor Splice Site of Intron 10 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
ACCACTCCTGCAAGTCATTCTGAATAGACATCTCATGGCACAATGGTTAATGACATGCATCACAAACAAAATACTCTCTCATACCTGAAGTGAGAAGGCCCGAAGAGCAGGAATTGGCACTAGGGCTGCCATGAAGAAAGCAATCATGTTATTAATTGAGGTAAGAGCCACACTGGTGCCAGTTCTTCTCAGGCAGTCACCTGTCCTCTCCTATGGAGATAAATAGAAAAAAATGAGCTGTGATCTTCAGCAACAACAACAGAAAATCTAAACAACATTTTCAGAGTTTAAAAGTCATGATCCAGAGCATGCTCATGAGATACATGCCTTGAATGGGATGTTGGATCGGGTCTCTGTGAAGGAATGAGCCAACAAGAACATGTCGTCAACTCCAATCCCCAAGGCTAGAAATGGTAGCACCTGTGGAGAAACACAAATTTCTGAGTTACAGCCAAGCCCTGAGGGTGGGTGTGAATTTAAGAGGTTTAGGTGTGTTTTTA
C/T CTGCGTGGTGGCGGCATTAAAGGACAGTCCCAACAGCGAACACAGTCCAAGTCCTGCAGCCACAGATAGAGCAACTAGCAGTACTCCTGCCAGCCCTACAGCACCCTGAGACTTCGCGCAGTCCCAGCGCAGCATGGTCACGCATGCGTATGCCAGCTGTGCATAAAAAGGGTATATGTAAGAGAATAGCTCCACACATATATGCTGATCACATTTTCATCAGCCTTAACTAGAGCAGCTACAGTAATTGATGTCTTACCATGAGCAGATAACCACCTGCCACCCTGATTACGCTGACGTCAGAGAAAGATTTCATGATGTCATTAAGAGTGGTTGTAGAGAAGGCATAAACATTGGAGGAAGAATTCTGAGGAATGCTCCCATGAACAACCTAGAAACAAATTCAAAATATGAACATTCAGAGAAAGAGAACTTATCCATTATTTGGATTTGACAGCCGTATGTATCAAGGAAAACTAGCATGACTTGTAAATAAAGTA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations