ZFIN ID: ZDB-GENE-980526-533

Mapping Details

Gene Name: homeobox C5a
Symbol: hoxc5a
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 23 39,222,567 - 39,224,492 GRCz12tu
NCBI Map Viewer 23 39,222,567 - 39,224,492 GRCz12tu
Ensembl 23 36,118,738 - 36,120,511 GRCz11
NCBI Map Viewer 23 36,118,674 - 36,120,511 GRCz11
UCSC 23 Based on NM_131144 GRCz11
Vega 23 36,019,935 - 36,021,708 GRCv10
Mapped Clones containing hoxc5a
DKEY-81P22 Chr: 23 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source Citations
la014424Tg 23 36,171,932 - 36,171,942 Zv9 ZFIN_Zv9
23 GRCz11 OTHER_MAPPING
23 GRCz11 OTHER_MAPPING
23 GRCz11 OTHER_MAPPING
23 GRCz11 OTHER_MAPPING

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
23 125.1 cM hoxc5a Mother of Pearl (MOP) Postlethwait, John H. Data
23 433.6 cR hoxc5 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
23 5381.0 cR hoxc5a Goodfellow T51 (T51) Geisler, Robert Data
23 105.1 cM hoxc5a Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
hoxc10a GENE 23 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a, hoxc11a, hoxc10a, hoxc9a, hoxc8a, hoxc6a, hoxc5a, hoxc4a, hoxc3a, and hoxc1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG23.
hoxc11a GENE 23 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a, hoxc11a, hoxc10a, hoxc9a, hoxc8a, hoxc6a, hoxc5a, hoxc4a, hoxc3a, and hoxc1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG23.
hoxc4a GENE 23 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a, hoxc11a, hoxc10a, hoxc9a, hoxc8a, hoxc6a, hoxc5a, hoxc4a, hoxc3a, and hoxc1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG23.
hoxc6a GENE 23 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a, hoxc11a, hoxc10a, hoxc9a, hoxc8a, hoxc6a, hoxc5a, hoxc4a, hoxc3a, and hoxc1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG23.
hoxc8a GENE 23 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a, hoxc11a, hoxc10a, hoxc9a, hoxc8a, hoxc6a, hoxc5a, hoxc4a, hoxc3a, and hoxc1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG23.
hoxc1a GENE 23 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a, hoxc11a, hoxc10a, hoxc9a, hoxc8a, hoxc6a, hoxc5a, hoxc4a, hoxc3a, and hoxc1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG23.
hoxc9a GENE 23 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a, hoxc11a, hoxc10a, hoxc9a, hoxc8a, hoxc6a, hoxc5a, hoxc4a, hoxc3a, and hoxc1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG23.
hoxc3a GENE 23 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a, hoxc11a, hoxc10a, hoxc9a, hoxc8a, hoxc6a, hoxc5a, hoxc4a, hoxc3a, and hoxc1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG23.
hoxc13a GENE 23 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a, hoxc11a, hoxc10a, hoxc9a, hoxc8a, hoxc6a, hoxc5a, hoxc4a, hoxc3a, and hoxc1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG23.
z3157 SSLP 23 Pratt et al., 2002 Pratt et al. (2002. Physiol Genomics 11: 91-98) report mapping nfe2 to Linkage Group 23, using both a genetic backcross panel as well as a radiation hybrid panel. They placed nfe2 2.17 +/- 2.15 cM from hoxc5a and 15.22 +/- 5.30 from SSLP z3157.
nfe2 GENE 23 2.17 cM Pratt et al., 2002 Pratt et al. (2002. Physiol Genomics 11: 91-98) report mapping nfe2 to Linkage Group 23, using both a genetic backcross panel as well as a radiation hybrid panel. They placed nfe2 2.17 +/- 2.15 cM from hoxc5a and 15.22 +/- 5.30 from SSLP z3157.
hoxc4a GENE 23 Woltering et al., 2006 Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10b-1 between hoxc4a and hoxc5a.
dre-mir-10b-2 MIRNAG 23 Woltering et al., 2006 Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10b-1 between hoxc4a and hoxc5a.

OTHER MAPPING INFORMATION
Chr 23 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a,  ...
Chr 23 Woltering et al., 2006 Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10b-1 between  ...
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 439 HhaI 36.0
Forward Primer CATTGTCAGTTTGGTTCATCTT
Reverse Primer GAACTCTTTCTCCAACTCCAG
Genomic Feature la014424Tg is an allele of hoxc5a