| ZFIN ID: ZDB-GENE-980526-44 |
| Gene Name: | patched 2 |
|---|---|
| Symbol: | ptch2 |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing ptch2 | |
|---|---|
| CH211-226H23 | Chr: 2 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | Citations |
|---|---|---|---|---|---|
| au1 | 2 | 33,983,412 | GRCz11 | DIRECT | Lee et al., 2012 |
| hu1602 | 2 | 33,978,923 | GRCz11 | DIRECT | Koudijs et al., 2008 |
| sa19807 | 2 | 36,956,599 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 2 | 33,983,706 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 2 | 34,000,488 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 2 | 33,701,581 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| sa38340 | 2 | 36,951,645 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 2 | 33,978,752 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 2 | 33,995,534 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 2 | 33,696,627 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| sa39869 | 2 | 36,942,416 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 2 | 33,969,523 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 2 | 33,986,305 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 2 | 33,687,398 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| sa44536 | 2 | 36,948,163 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 2 | 33,975,270 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 2 | 33,992,052 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 2 | 33,693,145 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| la010757Tg | 2 | 33,702,299 - 33,702,309 | Zv9 | ZFIN_Zv9 | |
| la014919Tg | 2 | 33,706,998 - 33,707,008 | Zv9 | ZFIN_Zv9 | |
| la028797Tg | 2 | 33,710,614 - 33,710,624 | Zv9 | ZFIN_Zv9 | |
| au1 | 2 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| hu1602 | 2 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| la010757Tg | 2 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| la014919Tg | 2 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| la028797Tg | 2 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| tc294z | 2 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 2 | 129.9 cM | ptc1 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 2 | 433.54 cR | ptc1 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 2 | 2851.0 cR | ptc1 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 2 | 89.7 cM | ptc1 | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z8451 | SSLP | 2 | Lee et al., 2008 | Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that ... | |
| z11410 | SSLP | 2 | Lee et al., 2008 | Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that ... | |
| z13521 | SSLP | 2 | Lee et al., 2008 | Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that ... | |
| z7632 | SSLP | 2 | Lee et al., 2008 | Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that ... | |
| atp6v0b | GENE | 2 | Lee et al., 2008 | Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that ... |
|
| Genomic Feature tc294z is an allele of ptch2 | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
||||||||||||||||||||||||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 480 | 36.0 | |
| Forward Primer | AGCAAGGAGCTACGCTACAC | ||
| Reverse Primer | GCAGGGGAAAAGCTTATCAA |
| Genomic Feature la010757Tg is an allele of ptch2 |