Transcript

rrm2-203

ID
ZDB-TSCRIPT-130528-81
Name
rrm2-203
Previous Names
  • rrm2-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058417 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058417|OTTDARG00000005867|ZDB-GENE-990415-25 rrm2|OTTDARP00000045669 rrm2-004 LG_ BX248136.12 Danio rerio protein_coding KNOWN, 472 bp
AGTGTTATCTTCGCTTCAGCTGGACCGTAGACCTGCTAGC
TCTTAGTTTTGCTTTTATTTATTTCTAGTTAACTTTGTTT
TAGAAGTTGTCTTTATTTTTAACCTTTAACTTATCCTCGT
TTTGTTTTACCAAACACTCCAAGCTTTACAATGTCGTCCA
CTCGCTCTCCCCTGAAAACCAAGAATGAAAACACAATCTC
TACTAAAATGAATAACATGTCCTTTGTGGACAAAGAAAAC
ACGCCACCCAGTTTGAGCTCCACCAGAATCCTGGCGTCCA
AAACGGCGCGCAAAATCTTTGATGAATCAGAGGGTCTTCA
TTGCGACTTCGCCTGCCTCATGTTTAAACACTTGATCAAC
AAACCATCAGAAGAAACCGTGAAGAAAATCATCATGAATG
CAGTTGAAATTGAGCAGGAGTTCCTGACTGATGCTCTTCC
CGTGAAGCTCATTGGCATGAACTGTGACCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations