Transcript

rrm2-204

ID
ZDB-TSCRIPT-130528-589
Name
rrm2-204
Previous Names
  • rrm2-005
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058419 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058419|OTTDARG00000005867|ZDB-GENE-990415-25 rrm2|OTTDARP00000045671 rrm2-005 LG_ BX248136.12 Danio rerio protein_coding KNOWN, 785 bp
CTTAGTTTTGCTTTTATTTATTTCTAGTTAACTTTGTTTT
AGAAGTTGTCTTTATTTTTAACCTTTAACTTATCCTCGTT
TTGTTTTACCAAACACTCCAAGCTTTACAATGTCGTCCAC
TCGCTCTCCCCTGAAAACCAAGAATGAAAACACAATCTCT
ACTAAAATGAATAACATGTCCTTTGTGGACAAAGAAAACA
CGCCACCCAGTTTGAGCTCCACCAGAATCCTGGCGTCCAA
AACGGCGCGCAAAATCTTTGATGAATCAGAGTCGAAAGCA
AAGAAAGGAGCAGTGGAGGAGGAGCCTCTTCTGAAGGAGA
ACCCCCATCGCTTTGTCATTTTCCCAATTCAGTATCATGA
CATCTGGCAGATGTACAAGAAGGCAGAGGCCTCTTTCTGG
ACAGCTGAGGAGGTTGATCTGTCCAAAGATCTGCAACACT
GGGATTCCCTGAAAGACGAGGAGAGATATTTCATCTCCCA
TGTTCTGGCTTTCTTTGCTGCAAGTGATGGCATTGTCAAT
GAGAACTTGGTGGAGCGTTTCACTCAGGAGGTCCAGGTGA
CTGAAGCCCGCTGCTTCTATGGCTTCCAGATAGCAATGGA
AAACATCCACTCAGAAATGTACAGCCTGTTGATTGACACC
TACATTAAAGATTCTAAAGAGAGGGAATTTCTGTTCAATG
CCATTGAGACAATGCCATGTGTAAAGAAGAAGGCTGACTG
GGCACTCAACTGGATTGGTGATAAAAATGCACGATATGGT
GAGAGAGTGGTGGCCTTTGCTGCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations