Transcript

rrm2-202

ID
ZDB-TSCRIPT-130528-335
Name
rrm2-202
Previous Names
  • rrm2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058418 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058418|OTTDARG00000005867|ZDB-GENE-990415-25 rrm2|OTTDARP00000045670 rrm2-002 LG_ BX248136.12 Danio rerio protein_coding KNOWN, 1023 bp
GAAAAACAAAGGATCTATACTCGTTGACTAGTTGTAAAAT
ACGTTTTCCGCTTAATTTGAGTTGTTTTTTTTATATGTCG
AGTTTAAAAATAATCAACAAAGTCCGTTGGAGTTCGTGTT
AACGGTTTAGTTGTGGTGAAGAACTGGCTAAACAGCTGAG
AGATTATTGTGGTGTAAAGTTTGATCGGCAATAAAATACT
GACACCTCTTTGATGACAGTAAATGTTATATTAATGATGT
GGTATTAGTGATATTATTGATGTCCAATATACGTTAATCT
TCGTGCTGAAGGACAGGAGAAACGACAACAAGACATTTAC
CTCTGTCATACGGAGGATTTGATGAAGCCACCCAGTTTGA
GCTCCACCAGAATCCTGGCGTCCAAAACGGCGCGCAAAAT
CTTTGATGAATCAGAGGGGCAGTCGAAAGCAAAGAAAGGA
GCAGTGGAGGAGGAGCCTCTTCTGAAGGAGAACCCCCATC
GCTTTGTCATTTTCCCAATTCAGTATCATGACATCTGGCA
GATGTACAAGAAGGCAGAGGCCTCTTTCTGGACAGCTGAG
GAGGTTGATCTGTCCAAAGATCTGCAACACTGGGATTCCC
TGAAAGACGAGGAGAGATATTTCATCTCCCATGTTCTGGC
TTTCTTTGCTGCAAGTGATGGCATTGTCAATGAGAACTTG
GTGGAGCGTTTCACTCAGGAGGTCCAGGTGACTGAAGCCC
GCTGCTTCTATGGCTTCCAGATAGCAATGGAAAACATCCA
CTCAGAAATGTACAGCCTGTTGATTGACACCTACATTAAA
GATTCTAAAGAGAGGGAATTTCTGTTCAATGCCATTGAGA
CAATGCCATGTGTAAAGAAGAAGGCTGACTGGGCACTCAA
CTGGATTGGTGATAAAAATGCACGATATGGTGAGAGAGTG
GTGGCCTTTGCTGCAGTGGAGGGAATCTTCTTCTCTGGGT
CTTTTGCTTCTATTTTCTGGCTAAAGAAGAGGGGACTCAT
GCCTGGACTCACCTTCTCCAATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations