Transcript

rrm2-201

ID
ZDB-TSCRIPT-090929-722
Name
rrm2-201
Previous Names
  • rrm2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006431 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006431|OTTDARG00000005867|ZDB-GENE-990415-25 rrm2|OTTDARP00000005724 rrm2-001 LG_ BX248136.12 Danio rerio protein_coding KNOWN, 2037 bp
GTGTTATCTTCGCTTCAGCTGGACCGTAGACCTGCTAGCT
CTTAGTTTTGCTTTTATTTATTTCTAGTTAACTTTGTTTT
AGAAGTTGTCTTTATTTTTAACCTTTAACTTATCCTCGTT
TTGTTTTACCAAACACTCCAAGCTTTACAATGTCGTCCAC
TCGCTCTCCCCTGAAAACCAAGAATGAAAACACAATCTCT
ACTAAAATGAATAACATGTCCTTTGTGGACAAAGAAAACA
CGCCACCCAGTTTGAGCTCCACCAGAATCCTGGCGTCCAA
AACGGCGCGCAAAATCTTTGATGAATCAGAGGGGCAGTCG
AAAGCAAAGAAAGGAGCAGTGGAGGAGGAGCCTCTTCTGA
AGGAGAACCCCCATCGCTTTGTCATTTTCCCAATTCAGTA
TCATGACATCTGGCAGATGTACAAGAAGGCAGAGGCCTCT
TTCTGGACAGCTGAGGAGGTTGATCTGTCCAAAGATCTGC
AACACTGGGATTCCCTGAAAGACGAGGAGAGATATTTCAT
CTCCCATGTTCTGGCTTTCTTTGCTGCAAGTGATGGCATT
GTCAATGAGAACTTGGTGGAGCGTTTCACTCAGGAGGTCC
AGGTGACTGAAGCCCGCTGCTTCTATGGCTTCCAGATAGC
AATGGAAAACATCCACTCAGAAATGTACAGCCTGTTGATT
GACACCTACATTAAAGATTCTAAAGAGAGGGAATTTCTGT
TCAATGCCATTGAGACAATGCCATGTGTAAAGAAGAAGGC
TGACTGGGCACTCAACTGGATTGGTGATAAAAATGCACGA
TATGGTGAGAGAGTGGTGGCCTTTGCTGCAGTGGAGGGAA
TCTTCTTCTCTGGGTCTTTTGCTTCTATTTTCTGGCTAAA
GAAGAGGGGACTCATGCCTGGACTCACCTTCTCCAATGAG
CTGATCAGCAGAGATGAGGGTCTTCATTGCGACTTCGCCT
GCCTCATGTTTAAACACTTGATCAACAAACCATCAGAAGA
AACCGTGAAGAAAATCATCATGAATGCAGTTGAAATTGAG
CAGGAGTTCCTGACTGATGCTCTTCCCGTGAAGCTCATTG
GCATGAACTGTGACCTGATGAAGCAATACATTGAGTTTGT
GGCTGACCGACTGTTATTGGAGCTGGGATTTGACAAGGTC
TATAGAGTGGAGAATCCTTTTGACTTCATGGAGAACATTT
CGTTGGAGGGCAAGACCAACTTCTTCGAGAAGCGAGTGGG
CGAGTACCAGCGCATGGGAGTCATGTCGGGAACTACAGAT
AACACTTTTACTCTGGATGCTGATTTTTAAAGACTCAATC
TGAGTGCTTCAACGGACACTTAACACAAAACTATGGACTT
CTGGGACTTTTGCTGTATAGTTTACATGTTTTTGTTTAAC
TTTGTTTTAGCGAGATTAGTATTAAATAAGCTTTTTTATT
TTTGTTTTACATAATAAAAAAAAAATTTGAATTTCAACTT
TTTGGATGAGGTATTGCTCGAAGTATCAAGTTAGGTTTTT
CAAGATATGGTAGCTCAATTTAGCCCAGACTCTATTTCGT
GTAAATGAGGTAAAATGAGTTATGGAGATTTATACTGCAT
TTAGTAGCTAGCTTGCCCCAGAGCAGACTAATAAGGCTAA
GACTAATCCTAGTGATTTATCTGTTAGTAATTCATTTAAG
TTACTCTGGCCATTTACTTATATTGGCAGTATAGATAATA
TTTCTCACTTCCATATAAAGTATGGGATCGACTCATAAAT
TAAGGTACAAATATAGAAACATGAATGGATAAAATAGATG
CTCCAATATTGGGTAAGAGTATGCAGTTAGTTATTTAATA
AACTTTCCTGTGTAACATGGTTGACTTTTGGTCACATTTA
ACACAAAGTAAACCACTGCTAATTTGATGGTTATACTTTG
GTGTAGGTAACTTTACAGCATCTTCCCAAACCAGAACAGG
GTTCGAGACATTGCCACACTGTCCATCAAATTTTTTTTTA
TTTTTTTTAAAAAAATCAATAAAGAGAAAAATCGTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations