Transcript

apex1-204

ID
ZDB-TSCRIPT-110912-41
Name
apex1-204
Previous Names
  • apex1-005
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051314 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051314|OTTDARG00000007616|ZDB-GENE-040426-2761 apex1|OTTDARP00000040342 apex1-005 LG_ BX323558.7 Danio rerio protein_coding KNOWN, 754 bp
GCTTCATTGTTTCATTCATTCAGGCCGCACTTCTGGCTAA
CTCACACATTTGGCTAATTCATGCTCGCTCGTTATTCCAG
CATACTGCAAGCACATGCATTTTGCTTTATGCAGATCACG
CACTTTATGTGTACGTGTGTGTGCTGTCAGTTTCTTTCGT
GTGTGTGGCCTGAAAACAACTGTAAACATGCCCAAAAGAG
CCAAGAAGAACGAGGAAGGTGTTGATGGAGAGTCTGACAA
TGGAACTGCAGCTGCAAAGAAAGAGAAAAAGGGGAAAGAG
CCCGAGGCCCCCATTCTATATGAAGATCCTCCAGAAAAGC
TGACCAGTAAGGACGGCCGGGCAGCCAATATGAAGATCAC
CTCCTGGAATGTGGACGGCCTGCGGGCGTGGGTCAAAAAG
AACGGACTTGATTGGGTGCGGAAGGAGGATCCAGACATCC
TGTGTCTGCAGGAAACCAAGTGTGCTGAGAAAGCTCTGCC
GGCGGACATCACTGGCATGCCAGAGTATCCACACAAATAC
TGGGCAGGATCAGAGGATAAGGAGGGCTACAGTGGAGTGG
CCATGCTCTGCAAGACCGAACCACTCAATGTCACCTATGG
CATTGGTAAAGAGGAGCACGATAAAGAGGGCCGGGTCATC
ACTGCCGAGTTTCCTGATTTCTTCCTGGTCACGGCGTACG
TGCCTAATGCCAGTCGTGGTTTAGTGCGGCTTGACTACCG
CAAGACTTGGGATGTGGATTTCCGAGCCTACCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations