Transcript

apex1-206

ID
ZDB-TSCRIPT-110912-341
Name
apex1-206
Previous Names
  • apex1-006
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051315 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051315|OTTDARG00000007616|ZDB-GENE-040426-2761 apex1|OTTDARP00000040343 apex1-006 LG_ BX323558.7 Danio rerio protein_coding KNOWN, 682 bp
AGATCCTCCAGAAAAGCTGACCAGTAAGGACGGCCGGGCA
GCCAATATGAAGATCACCTCCTGGAATGTGGACGGCCTGC
GGGCGTGGGTCAAAAAGAACGGACTTGATTGGGTGCGGAA
GGAGGATCCAGACATCCTGTGTCTGCAGGAAACCAAGTGT
GCTGAGAAAGCTCTGCCGGCGGACATCACTGGCATGCCAG
AGTATCCACACAAATACTGGGCAGGATCAGAGGATAAGGA
GGGCTACAGTGGAGTGGCCATGCTCTGCAAGACCGAACCA
CTCAATGTCACCTATGGCATTGGTAAGAGTAACCATGCAT
GCTTATGTATTCTCCAAACTGAGTTATAATGCACTTAAAC
TAGGTCCTGAAGGGCCGGTGTCCAGCATATTTTAGTTCCA
ACCCCAATTAAACACACCAGGACCAGCTAACCAAGCATTT
TCAAGGTATACTAGGAAGTGTGTGAAGGAAGTTGGAGCTA
AACTATGCAGGAAACCGACCCTCCAGGACCAGTTTGGACA
CCCCTGACTTACAGCAAGCAGCTTTATCTTTCATTAAAGG
GATAGTTCACCCAAAACTTAAAAACGTCAGTCATCATTTA
CTTTAAAAACCTCCGTACGTTTCTAGGTAAAGAGGAGCAC
GATAAAGAGGGCCGGGTCATCACTGCCGAGTTTCCTGATT
TC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations