Transcript

apex1-205

ID
ZDB-TSCRIPT-110912-340
Name
apex1-205
Previous Names
  • apex1-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051312 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051312|OTTDARG00000007616|ZDB-GENE-040426-2761 apex1|OTTDARP00000040340 apex1-003 LG_ BX323558.7 Danio rerio protein_coding KNOWN, 388 bp
GCACACTTCTGCACAGATTGAGCTTTCTCTGTTATCTGAA
CTAAACAATAAAGTGTTGGCATACTGCAAGCACATGCATT
TTGCTTTATGCAGATCACGCACTTTATGTGTACGTGTGTG
TGCTGTCAGTTTCTTTCGTGTGTGTGGCCTGAAAACAACT
GTAAACATGCCCAAAAGAGCCAAGAAGAACGAGGAAGGTG
TTGATGGAGAGTCTGACAATGGAACTGCTGCAAAGAAAGA
GAAAAAGGGGAAAGAGCCCGAGGCCCCCATTCTATATGAA
GATCCTCCAGAAAAGCTGACCAGTAAGGACGGCCGGGCAG
CCAATATGAAGATCACCTCCTGGAATGTGGACGGCCTGCG
GGCGTGGGTCAAAAAGAACGGACTTGAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations