Transcript

sfpq-202

ID
ZDB-TSCRIPT-090929-5081
Name
sfpq-202
Previous Names
  • sfpq-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021393 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021393|OTTDARG00000015419|ZDB-GENE-040426-2452 sfpq|OTTDARP00000042680 sfpq-004 LG_none BX957260.10,CR749172.5 Danio rerio protein_coding KNOWN, 688 bp
TTTATAGAGCCTTTAACAAAGGCTGAACGCCGCACCGGTT
CCTCGTCGCCCATTTCAGTATAAAAATGCATTTTAACTGC
TTGGTTGAGATTATAAGTTAAAGAATTGAAGGCAACGCTC
TCTTTGCTGCGCAAGCCTGGGGAGAAAACATACACCCAAC
GTTGTCGTCTTTTTATCGGGAACCTTCCAAACGACATCAC
TGAACCCGAATTCAGGAAATTGTTCGCAAAGTATGGGGAA
CCCAGTGAGATTTTCATCAATCAAGGCAAAGGCTTTGGAT
TCATCCGTCTGGAATCCCGTGCCTTGGCAGAGGTTGCGAA
AGCAGAGTTGGATGATACTCCAATGAAAGGCAGACCACTC
CGAGTTCGCTTCGCTACTCATTCTGCTGCACTTTCTGTGC
GAAATCTATCTCCGTTCGTGTCCAATGAGCTGCTGGAGGA
GGCATTCTCTCAGTTTGGACTGGTGGAAAGGGCTATAGTC
ATCGTGGATGACCGTGGACGCTCAACAGGGAAAGGCATTG
TTGAGTTTTCTTCTAAGCCAGCTGCCCGCAAGGCCATGGA
TCGCATTAGTGATGGGGTGTTCCTTCTCACATCGTCCCCC
CGTCCAATTGTGGTTGAATTGTTGGAGCAGTATGATGACG
AGGACGGTTTGCCCGAGAAGCTTGCACAGAAAAACCCCAG
TTATCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations