Transcript

sfpq-204

ID
ZDB-TSCRIPT-090929-4094
Name
sfpq-204
Previous Names
  • sfpq-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000018475 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000018475|OTTDARG00000015419|ZDB-GENE-040426-2452 sfpq|OTTDARP00000042679 sfpq-002 LG_none BX957260.10,CR749172.5 Danio rerio protein_coding KNOWN, 2273 bp
AGAGTGCGCTTTCAACACGTTGGCACTTTAAGGGGTGGAG
TTTCTCGTTCACGTCATTTCTCCCATTTTTACAGTCTTTT
CTTGCAGCCAGCGGCCATTTTACAAAGCTGCCGCCGAGCG
TGAGGGTGCTCCTCTCTTTGTCGGTGTTTATCGTTACAGT
TGCATTTAGTACGTGATTTAAAACTCACCAATATTCATTT
TTATACGGTTTATCCCGTCCGCTTCTGTGTGATAATGTCT
CGTGACCGATCTCGTAATCGTGGAGGATTCCAGCCCCGAG
GCCGCGGAGGAATGGGGATGCGCGGTGGCATGGGCATGGG
GATGGGTATGGGCATGGGAATGGGAATGGGGATGGGGATG
GGAATGGGAAACCCGAACTTTCGAAATCAAAACCAGCACC
ATTTTCAAAACCGAGGCCCACAAATGGGTGGTGGATTTAG
GCAGAATCAGGGAAATCAAGGCAACCAGGTATCTACACAA
CAGAAGCCGCAGGAACCCGCACAGAACAAGCCCGTCGTGC
AGACTCCTCCTGCGCAAGGCCCCGGTCAGGCCCAGCAGGC
CGCCAACAAAGGCCCGACGCCCCAGCAGACTCCCACCGTC
GCTCCGCCGAAAATCCAGTCTGCTCCACCGAAGATCCAGT
CTCCTCCGCCGAAGATTCAGTCTCCTCCGCCAGCACAGAA
TAACGCGAAGACGCCAGAAATAGCTTCCCCTCAAAACCAG
CAAAGGAAGAACCTACCCAAACCCGCGATGGGGAATGGCC
AGAAGCCGCCTGCTCCCTTGAAGCAAGAGCAGACGCCAGC
ACCAACACCCCCACCAGCACAACAACAGCAGCAACAGCAA
CAACAACAAAAACAGACTCCCGCAAACGAGCAGAGCTCTC
AGCCCCAGGAATTGAAGGCAACGCTCTCTTTGCTGCGCAA
GCCTGGGGAGAAAACATACACCCAACGTTGTCGTCTTTTT
ATCGGGAACCTTCCAAACGACATCACTGAACCCGAATTCA
GGAAATTGTTCGCAAAGTATGGGGAACCCAGTGAGATTTT
CATCAATCAAGGCAAAGGCTTTGGATTCATCCGTCTGGAA
TCCCGTGCCTTGGCAGAGGTTGCGAAAGCAGAGTTGGATG
ATACTCCAATGAAAGGCAGACCACTCCGAGTTCGCTTCGC
TACTCATTCTGCTGCACTTTCTGTGCGAAATCTATCTCCG
TTCGTGTCCAATGAGCTGCTGGAGGAGGCATTCTCTCAGT
TTGGACTGGTGGAAAGGGCTATAGTCATCGTGGATGACCG
TGGACGCTCAACAGGGAAAGGCATTGTTGAGTTTTCTTCT
AAGCCAGCTGCCCGCAAGGCCATGGATCGCATTAGTGATG
GGGTGTTCCTTCTCACATCGTCCCCCCGTCCAATTGTGGT
TGAATTGTTGGAGCAGTATGATGACGAGGACGGTTTGCCC
GAGAAGCTTGCACAGAAAAACCCCAGTTATCAAAAGGAAC
GAGAGCAACCTCCTCGGTTTGCCCGTCCTGGCACCTTTGA
GTATGAATACTCCCAGCGATGGAAGTCCCTTGATGAGATG
GAGAAACAGCAGAGGCAGCAAGTGGAGAAAAACATCTGTG
AAGCCCGTGAGAAGCTGGAAACGGAGATGGACGATGCATA
TCATGAGCATCAAGCGAACATGCTCAGACAGGATCTCCTT
AGACGTCAAGAGGAACTTCGCCGCATGGAGGAGCTGCACA
GTCAGGAGATGCAGAAGCGTAAAGAGATGCAGCTTAGGCA
AGAAGAGGAACGTCGTAGGAGAGAGGAGGAGATGATGCGG
CAGAGGGAAATCGAAGAACAATTGAGGCGCAAACGCGAGG
AATCTTACAGAATGAACAACTTCATGGATAATAGAGACAG
GGAGATGAGAATGAACACAAGTGGAGGCATGGGATTGTCT
GATATGTCATTTGGATCACCAAACCAGAAGTTCTCATTGA
CCGGAATGAGCTTTGATGGACACCAGGGACTAAGTGGATC
AACACAAGGGGGCCTAGCGTCCAACGAAATGGGCTCTCGG
GTGATTGAAGCAGGTTAAGAAGCATCGTGCGATTGAAAAC
ATGGATCTTAAACCGAAGAAGCTGTTCTCTGAACGGTCGA
CTGACTTTCACAGCCCCAGATGTTCAGTGATAGATGTTCC
TGCACAGTGGATAGAAATGTGCAGACATGTTGGAGACTGA
CGCAATCTGGCAGATGGCTCTGGATGCCTCAAATATATCT
ATTTTTATTTAAATAAACTTAAAATTCCTTCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations