Transcript

sfpq-003

ID
ZDB-TSCRIPT-090929-4095
Name
sfpq-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000018476 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000018476|OTTDARG00000015419|ZDB-GENE-040426-2452 sfpq|no_translation sfpq-003 LG_none BX957260.10,CR749172.5 Danio rerio protein_coding KNOWN, 818 bp
GGGTGGATGGGTAAATGTTTGTCTGCACTGTGATCCATTT
GCCTTGGTCCCAGCCTGTCATTTTGATAACTATAATAAGG
ACCATAACTTATTTTAACCTCTATGGAGTGTGATGCCAGA
ATTGCCCTTGTCCTGATGGCTACTTCAGAGAGCCAGGTCT
TTAACCTTACACATTTTAGCAATCCGGGATTGCGTTTGAA
GTGTTGTTGTCTGTATGGAAATGAGTTCATCATCTACCCT
GTGAATTATTGAGCTTTACAGCAACCATAACATTGTTTCT
GCATGAGATTAAATAATAATGGCTCTTTGGCAGTGTATAT
ATAAATATTAGGTATATTTGTATTATTCTAGCTGTAATTC
TGAACATTCTTAGCCAGTTACTTGCACATTTTTATTTGTG
CTTGTAGTTTTGGTGATGCAGGAGTTTTGATTTTTGTAGA
AAGAACTAAAATAGCTGTAATTATATTATATTGTATGTTA
ACCCAATGTATTTTTTCTATATATGTGTATATTTAGAAGT
CAATTGTGTAAAGTACTAAAGTAGGACTTGCTGCATTACT
ATCCTTCTGTATTCTCACTGTTTGTCTCTCACTGCAGGGC
TCTCGGGTGATTGAAGCAGGTTAAGAAGCATCGTGCGATT
GAAAACATGGATCTTAAACCGAAGAAGCTGTTCTCTGAAC
GGTCGACTGACTTTCACAGCCCCAGATGTTCAGTGATAGA
TGTTCCTGCACAGTGGATAGAAATGTGCAGACATGTTGGA
GACTGACGCAATCTGGCAGATGGCTCTGGATGCCTCAAAT
ATATCTATTTTTATTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations