Transcript

sfpq-201

ID
ZDB-TSCRIPT-090929-4093
Name
sfpq-201
Previous Names
  • sfpq-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000018474 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000018474|OTTDARG00000015419|ZDB-GENE-040426-2452 sfpq|OTTDARP00000015599 sfpq-001 LG_none BX957260.10,CR749172.5 Danio rerio protein_coding KNOWN, 2424 bp
CCGAGCGTGAGGGTGCTCCTCTCTTTGTCGGTGTTTATCG
TTACAGTTGCATTTAGTACGTGATTTAAAACTCACCAATA
TTCATTTTTATACGGTTTATCCCGTCCGCTTCTGTGTGAT
AATGTCTCGTGACCGATCTCGTAATCGTGGAGGATTCCAG
CCCCGAGGCCGCGGAGGAATGGGGATGCGCGGTGGCATGG
GCATGGGGATGGGTATGGGCATGGGAATGGGAATGGGGAT
GGGGATGGGAATGGGAAACCCGAACTTTCGAAATCAAAAC
CAGCACCATTTTCAAAACCGAGGCCCACAAATGGGTGGTG
GATTTAGGCAGAATCAGGGAAATCAAGGCAACCAGGTATC
TACACAACAGAAGCCGCAGGAACCCGCACAGAACAAGCCC
GTCGTGCAGACTCCTCCTGCGCAAGGCCCCGGTCAGGCCC
AGCAGGCCGCCAACAAAGGCCCGACGCCCCAGCAGACTCC
CACCGTCGCTCCGCCGAAAATCCAGTCTGCTCCACCGAAG
ATCCAGTCTCCTCCGCCGAAGATTCAGTCTCCTCCGCCAG
CACAGAATAACGCGAAGACGCCAGAAATAGCTTCCCCTCA
AAACCAGCAAAGGAAGAACCTACCCAAACCCGCGATGGGG
AATGGCCAGAAGCCGCCTGCTCCCTTGAAGCAAGAGCAGA
CGCCAGCACCAACACCCCCACCAGCACAACAACAGCAGCA
ACAGCAACAACAACAAAAACAGACTCCCGCAAACGAGCAG
AGCTCTCAGCCCCAGGAATTGAAGGCAACGCTCTCTTTGC
TGCGCAAGCCTGGGGAGAAAACATACACCCAACGTTGTCG
TCTTTTTATCGGGAACCTTCCAAACGACATCACTGAACCC
GAATTCAGGAAATTGTTCGCAAAGTATGGGGAACCCAGTG
AGATTTTCATCAATCAAGGCAAAGGCTTTGGATTCATCCG
TCTGGAATCCCGTGCCTTGGCAGAGGTTGCGAAAGCAGAG
TTGGATGATACTCCAATGAAAGGCAGACCACTCCGAGTTC
GCTTCGCTACTCATTCTGCTGCACTTTCTGTGCGAAATCT
ATCTCCGTTCGTGTCCAATGAGCTGCTGGAGGAGGCATTC
TCTCAGTTTGGACTGGTGGAAAGGGCTATAGTCATCGTGG
ATGACCGTGGACGCTCAACAGGGAAAGGCATTGTTGAGTT
TTCTTCTAAGCCAGCTGCCCGCAAGGCCATGGATCGCATT
AGTGATGGGGTGTTCCTTCTCACATCGTCCCCCCGTCCAA
TTGTGGTTGAATTGTTGGAGCAGTATGATGACGAGGACGG
TTTGCCCGAGAAGCTTGCACAGAAAAACCCCAGTTATCAA
AAGGAACGAGAGCAACCTCCTCGGTTTGCCCGTCCTGGCA
CCTTTGAGTATGAATACTCCCAGCGATGGAAGTCCCTTGA
TGAGATGGAGAAACAGCAGAGGCAGCAAGTGGAGAAAAAC
ATCTGTGAAGCCCGTGAGAAGCTGGAAACGGAGATGGACG
ATGCATATCATGAGCATCAAGCGAACATGCTCAGACAGGA
TCTCCTTAGACGTCAAGAGGAACTTCGCCGCATGGAGGAG
CTGCACAGTCAGGAGATGCAGAAGCGTAAAGAGATGCAGC
TTAGGCAAGAAGAGGAACGTCGTAGGAGAGAGGAGGAGAT
GATGCGGCAGAGGGAAATCGAAGAACAATTGAGGCGCAAA
CGCGAGGAATCTTACAGAATGAACAACTTCATGGATAATA
GAGACAGGGAGATGAGAATGAACACAAGTGGAGGCATGGG
ATTGTCTGATATGTCATTTGGATCACCAAACCAGAAGTTC
TCATTGACCGGAATGAGCTTTGATGGACACCAGGGACTAA
GTGGATCAACACAAGGGGGCCTAGCGTCCAACGAAATGCG
CAATGATCGTTTCCAGCAAGGTGGCTCAGGGGGTCAGAGG
GGCATTGGTGCTGGAAATTCAGGATTTGGCAGGGTCCGTG
AGGAATTTGATGGACCTGCCAAGAAGCCACGCTTCTGATC
TGGCACTTTAAAAGCAAAGCTTGTATGTGGAATTCCAGAG
ACTCTGATTTAGAGTCACAATTGATGTATTTAAGTTTAAA
GAATTTTCTTGCAGTTTTAGCCTGAAAACTCATCCCATTT
GTGGCAAGATTTTTTTTCATCATATTTTTATTTTGTATTC
TTAATAGGTTTAATAATAAAACAACTGAAGTCAGAACAAG
CATAGTGCTTCTAACATGTAATCCCTACTCGTACTAGTCT
TTATCTTGTCATGTTGCTTGTGTTATACTGGTGAATATTG
TAAATTTGTTCTGATCTTTCTATGGCTGTGTTCTGTGCCA
TTCACATTTAAAATACTTCATGTACATTTTCAATAAAGAG
TGCAGTTGGTTCTCCCAAACCCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations