TALEN

TALEN1-smyhc1,smyhc2,smyhc3

ID

ZDB-TALEN-210902-1

Previous Names

None

Targets

smyhc1 (1)
smyhc2 (1)
smyhc3 (1)

Target Sequence 1

5' - TGAGGTCAACTCACCCTC - 3'

Target Sequence 2

5' - CTTAGTCTCATTGGGGATCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genome Build: GRCz11Chromosome: 24

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
stl582	smyhc1
stl584	smyhc1

Expression

Gene expression in Wild Types + TALEN1-smyhc1,smyhc2,smyhc3

No data available

Phenotype

Phenotype resulting from TALEN1-smyhc1,smyhc2,smyhc3

No data available

Phenotype of all Fish created by or utilizing TALEN1-smyhc1,smyhc2,smyhc3

Phenotype	Fish	Conditions	Figures
post-vent region kinked, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 4 from Whittle et al., 2020
slow muscle cell disorganized, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 6 from Whittle et al., 2020
muscle cell ab-f59 labeling absent, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 1 from Whittle et al., 2020
trunk kinked, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 4 from Whittle et al., 2020
vertebral column kinked, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 4 from Whittle et al., 2020
slow muscle cell Z disc ab1-actn labeling absent, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 6 from Whittle et al., 2020
whole organism decreased life span, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 3 from Whittle et al., 2020
whole organism dead, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 3 from Whittle et al., 2020
whole organism paralysed, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 2 from Whittle et al., 2020
slow muscle cell actin filament punctate, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 6 from Whittle et al., 2020
slow muscle cell shape, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 6 from Whittle et al., 2020
slow muscle cell Z disc absent, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 6 from Whittle et al., 2020
post-vent region curved dorsal, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 4 from Whittle et al., 2020
whole organism ab-f59 labeling absent, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 1 from Whittle et al., 2020
slow muscle cell Z disc ab1-actn labeling spatial pattern, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 6 from Whittle et al., 2020
motor behavior decreased process quality, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 5 from Whittle et al., 2020
post-vent region kinked, abnormal	smyhc1^{stl584/stl584}	control	Figure 2 , Figure 7 from Whittle et al., 2020
slow muscle cell disorganized, abnormal	smyhc1^{stl584/stl584}	standard conditions	Figure 6 from Whittle et al., 2020
trunk kinked, abnormal	smyhc1^{stl584/stl584}	control	Figure 2 , Figure 7 from Whittle et al., 2020
trunk shape, ameliorated	smyhc1^{stl584/stl584}	chemical treatment: blebbistatin	Figure 7 from Whittle et al., 2020
somite decreased length, abnormal	smyhc1^{stl584/stl584}	standard conditions	Figure 6 from Whittle et al., 2020
post-vent region shape, ameliorated	smyhc1^{stl584/stl584}	chemical treatment: blebbistatin	Figure 7 from Whittle et al., 2020
myotome decreased length, abnormal	smyhc1^{stl584/stl584}	standard conditions	Figure 6 from Whittle et al., 2020
notochord kinked, abnormal	smyhc1^{stl584/stl584}	standard conditions	Figure 2 from Whittle et al., 2020
pericardium edematous, abnormal	smyhc1^{stl584/stl584}	chemical treatment: blebbistatin	Figure 7 from Whittle et al., 2020
slow muscle cell actin filament punctate, abnormal	smyhc1^{stl584/stl584}	standard conditions	Figure 6 from Whittle et al., 2020
slow muscle cell shape, abnormal	smyhc1^{stl584/stl584}	standard conditions	Figure 6 from Whittle et al., 2020
slow muscle cell Z disc ab1-actn labeling spatial pattern, abnormal	smyhc1^{stl584/stl584}	standard conditions	Figure 6 from Whittle et al., 2020
slow muscle cell Z disc disorganized, abnormal	smyhc1^{stl584/stl584}	standard conditions	Figure 6 from Whittle et al., 2020
post-vent region curved dorsal, abnormal	smyhc1^{stl584/stl584}	chemical treatment: blebbistatin	Figure 7 from Whittle et al., 2020
post-vent region kinked, abnormal	smyhc1^stl584/+	control	Figure 4 , Figure 7 from Whittle et al., 2020
slow muscle cell disorganized, abnormal	smyhc1^stl584/+	standard conditions	Figure 6 from Whittle et al., 2020
trunk kinked, abnormal	smyhc1^stl584/+	control	Figure 4 , Figure 7 from Whittle et al., 2020
trunk shape, ameliorated	smyhc1^stl584/+	chemical treatment: blebbistatin	Figure 7 from Whittle et al., 2020
post-vent region shape, ameliorated	smyhc1^stl584/+	chemical treatment: blebbistatin	Figure 7 from Whittle et al., 2020
vertebral column kinked, abnormal	smyhc1^stl584/+	standard conditions	Figure 4 from Whittle et al., 2020
myotome decreased length, abnormal	smyhc1^stl584/+	standard conditions	Figure 6 from Whittle et al., 2020
notochord kinked, abnormal	smyhc1^stl584/+	standard conditions	Figure 2 from Whittle et al., 2020
whole organism decreased life span, abnormal	smyhc1^stl584/+	standard conditions	Figure 3 from Whittle et al., 2020
pericardium edematous, abnormal	smyhc1^stl584/+	chemical treatment: blebbistatin	Figure 7 from Whittle et al., 2020
whole organism dead, abnormal	smyhc1^stl584/+	standard conditions	Figure 3 from Whittle et al., 2020
slow muscle cell actin filament punctate, abnormal	smyhc1^stl584/+	standard conditions	Figure 6 from Whittle et al., 2020
slow muscle cell shape, abnormal	smyhc1^stl584/+	standard conditions	Figure 6 from Whittle et al., 2020
post-vent region curved dorsal, abnormal	smyhc1^stl584/+	standard conditions	Figure 4 from Whittle et al., 2020
somite decreased length, abnormal	smyhc1^stl584/+	standard conditions	Figure 6 from Whittle et al., 2020
post-vent region curved dorsal, abnormal	smyhc1^stl584/+	chemical treatment: blebbistatin	Figure 7 from Whittle et al., 2020
motor behavior decreased process quality, abnormal	smyhc1^stl584/+	standard conditions	Figure 5 from Whittle et al., 2020
trunk kinked, abnormal	smyhc1^stl584/+; smyhc1^stl582/+	standard conditions	Figure 2 from Whittle et al., 2020
post-vent region kinked, abnormal	smyhc1^stl584/+; smyhc1^stl582/+	standard conditions	Figure 2 from Whittle et al., 2020
notochord kinked, abnormal	smyhc1^stl584/+; smyhc1^stl582/+	standard conditions	Figure 2 from Whittle et al., 2020

Citations

Include unpublished citations

Whittle, J., Antunes, L., Harris, M., Upshaw, Z., Sepich, D.S., Johnson, A.N., Mokalled, M., Solnica-Krezel, L., Dobbs, M.B., Gurnett, C.A. (2020) MYH3-associated distal arthrogryposis zebrafish model is normalized with para-aminoblebbistatin. EMBO Molecular Medicine. 12(11):e12356

1 - 1 of 1

Show