TALEN

TALEN1-clec14a

ID
ZDB-TALEN-191016-1
Name
TALEN1-clec14a
Previous Names
None
Target
Target Sequence 1
5' - TGTTCACTTGAACAAAAACT - 3'
Target Sequence 2
5' - TCCAGGTTTGCAATAATTCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 17
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ci15 clec14a
Expression
Gene expression in Wild Types + TALEN1-clec14a
No data available
Phenotype
Phenotype resulting from TALEN1-clec14a
No data available
Phenotype of all Fish created by or utilizing TALEN1-clec14a
Phenotype Fish Conditions Figures
axial vasculature kdrl expression spatial pattern, abnormal clec14aci15/ci15 standard conditions Fig. 5 with image from Pociute et al., 2019
embryonic blood vessel endothelial progenitor cell cdh5 expression decreased amount, abnormal clec14aci15/ci15 standard conditions Fig. 4 with image from Pociute et al., 2019
intermediate cell mass of mesoderm clec14a expression decreased amount, abnormal clec14aci15/ci15 standard conditions Fig. 1 with image from Pociute et al., 2019
embryonic blood vessel endothelial progenitor cell kdrl expression decreased amount, abnormal clec14aci15/ci15 standard conditions Fig. 4 with image from Pociute et al., 2019
sprouting angiogenesis delayed, abnormal clec14aci15/ci15; s843Tg standard conditions Fig. 2 with imageFig. 4 with imageFig. 5 with image from Pociute et al., 2019
intersegmental vessel angiogenic sprout decreased length, abnormal clec14aci15/ci15; s843Tg standard conditions Fig. 2 with imageFig. 5 with image from Pociute et al., 2019
parachordal vessel incomplete structure, abnormal clec14aci15/ci15; s843Tg standard conditions Fig. 2 with image from Pociute et al., 2019
intersegmental vessel decreased amount, abnormal clec14aci15/ci15; s843Tg standard conditions Fig. 5 with image from Pociute et al., 2019
dorsal longitudinal anastomotic vessel immature, abnormal clec14aci15/ci15; s843Tg standard conditions Fig. 2 with image from Pociute et al., 2019
intersegmental vessel cldn5b expression spatial pattern, abnormal clec14aci15/ci15 + MO1-cd93 standard conditions Fig. 3 with image from Pociute et al., 2019
intersegmental vessel kdrl expression decreased amount, abnormal clec14aci15/ci15 + MO1-cd93 standard conditions Fig. 3 with image from Pociute et al., 2019
intersegmental vessel fli1 expression decreased amount, abnormal clec14aci15/ci15 + MO1-cd93 standard conditions Fig. 3 with image from Pociute et al., 2019
intersegmental vessel cdh5 expression spatial pattern, abnormal clec14aci15/ci15 + MO1-cd93 standard conditions Fig. 3 with image from Pociute et al., 2019
intersegmental vessel cldn5b expression decreased amount, abnormal clec14aci15/ci15 + MO1-cd93 standard conditions Fig. 3 with image from Pociute et al., 2019
intersegmental vessel kdrl expression spatial pattern, abnormal clec14aci15/ci15 + MO1-cd93 standard conditions Fig. 3 with image from Pociute et al., 2019
intersegmental vessel fli1 expression spatial pattern, abnormal clec14aci15/ci15 + MO1-cd93 standard conditions Fig. 3 with image from Pociute et al., 2019
intersegmental vessel cdh5 expression decreased amount, abnormal clec14aci15/ci15 + MO1-cd93 standard conditions Fig. 3 with image from Pociute et al., 2019
axial vasculature kdrl expression spatial pattern, abnormal clec14aci15/ci15 + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
embryonic blood vessel endothelial progenitor cell kdrl expression decreased amount, abnormal clec14aci15/ci15 + MO2-etsrp standard conditions Fig. 4 with image from Pociute et al., 2019
embryonic blood vessel endothelial progenitor cell kdrl expression decreased distribution, abnormal clec14aci15/ci15 + MO2-etsrp standard conditions Fig. 4 with image from Pociute et al., 2019
embryonic blood vessel endothelial progenitor cell cdh5 expression decreased amount, abnormal clec14aci15/ci15 + MO2-etsrp standard conditions Fig. 4 with image from Pociute et al., 2019
embryonic blood vessel endothelial progenitor cell cdh5 expression decreased distribution, abnormal clec14aci15/ci15 + MO2-etsrp standard conditions Fig. 4 with image from Pociute et al., 2019
sprouting angiogenesis delayed, abnormal clec14aci15/ci15; s843Tg + MO1-cd93 standard conditions Fig. 2 with image from Pociute et al., 2019
sprouting angiogenesis delayed, exacerbated clec14aci15/ci15; s843Tg + MO1-cd93 standard conditions Fig. 2 with image from Pociute et al., 2019
parachordal vessel incomplete structure, exacerbated clec14aci15/ci15; s843Tg + MO1-cd93 standard conditions Fig. 2 with image from Pociute et al., 2019
angiogenic sprout mislocalised, abnormal clec14aci15/ci15; s843Tg + MO1-cd93 standard conditions Fig. 2 with image from Pociute et al., 2019
intersegmental vessel angiogenic sprout decreased length, exacerbated clec14aci15/ci15; s843Tg + MO1-cd93 standard conditions Fig. 2 with image from Pociute et al., 2019
intersegmental vessel angiogenic sprout decreased length, abnormal clec14aci15/ci15; s843Tg + MO1-cd93 standard conditions Fig. 2 with image from Pociute et al., 2019
dorsal longitudinal anastomotic vessel immature, exacerbated clec14aci15/ci15; s843Tg + MO1-cd93 standard conditions Fig. 2 with image from Pociute et al., 2019
intersegmental vessel decreased length, abnormal clec14aci15/ci15; s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
intersegmental vessel decreased amount, exacerbated clec14aci15/ci15; s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
dorsal longitudinal anastomotic vessel immature, abnormal clec14aci15/ci15; s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
sprouting angiogenesis delayed, exacerbated clec14aci15/ci15; s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
parachordal vessel incomplete structure, exacerbated clec14aci15/ci15; s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
intersegmental vessel angiogenic sprout decreased length, exacerbated clec14aci15/ci15; s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
sprouting angiogenesis delayed, exacerbated clec14aci15/ci15; s843Tg + MO2-etsrp standard conditions Fig. 4 with image from Pociute et al., 2019
intersegmental vessel angiogenic sprout decreased length, exacerbated clec14aci15/ci15; s843Tg + MO2-etsrp standard conditions Fig. 4 with image from Pociute et al., 2019
angiogenic sprout mislocalised, exacerbated clec14aci15/ci15; s843Tg + MO2-etsrp standard conditions Fig. 4 with image from Pociute et al., 2019
Citations