TALEN

TALEN1-gdf3

ID
ZDB-TALEN-170925-1
Name
TALEN1-gdf3
Previous Names
None
Target
Target Sequence 1
5' - GTCTTCTGACCCTCAGTCT - 3'
ZFIN BLAST NCBI BLAST Ensembl
Target Sequence 2
5' - CTTGCACAAGACCATCATCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zy51 gdf3
zy52 gdf3
zy53 gdf3
Expression
Gene expression in Wild Types + TALEN1-gdf3
No data available
Phenotype
Phenotype resulting from TALEN1-gdf3
No data available
Phenotype of all Fish created by or utilizing TALEN1-gdf3
Phenotype Fish Conditions Figures
endoderm sox17 expression decreased amount, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
somite myod1 expression spatial pattern, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
endoderm foxa2 expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
pharyngeal endoderm absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
notochord tbxta expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
prechordal plate gsc expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
brain ventro-medial region foxa2 expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
margin ventral region eve1 expression decreased distribution, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
germ ring dorsal region tbxta expression decreased amount, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 3 with image from Bisgrove et al., 2017
prechordal plate lft1 expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
spinal cord neuron tbx16 expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
germ ring tbxta expression spatial pattern, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 3 with image from Bisgrove et al., 2017
axial chorda mesoderm lft1 expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
neuroectoderm ndr2 expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
prechordal plate lft2 expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
pharyngeal endoderm foxa2 expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
central nervous system anterior region malformed, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 1 with image,  Fig. 3 with image from Bisgrove et al., 2017
eye fused with eye, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
whole organism morphology, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 3 with image from Bisgrove et al., 2017
neuroectoderm gsc expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
somite decreased size, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
axial mesoderm anterior region ndr2 expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
forerunner cell group sox17 expression decreased amount, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
notochord absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 1 with image,  Fig. 3 with image from Bisgrove et al., 2017
hypoblast lft1 expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
axial chorda mesoderm tbxta expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
pharyngeal mesoderm hand2 expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
axial mesoderm posterior region ndr2 expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
heart tube hand2 expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
neuroectoderm lft2 expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
floor plate spinal cord region foxa2 expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
axial hypoblast foxa2 expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
anterior neural plate otx2b expression decreased distribution, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
pectoral fin bud hand2 expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
neuroectoderm lft1 expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
somite U-shaped, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
prechordal plate tbx16 expression decreased distribution, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
germ ring gsc expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 3 with image from Bisgrove et al., 2017
hypoblast tbx16 expression absent, abnormal gdf3zy51/zy51 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
endoderm sox17 expression decreased amount, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
somite myod1 expression spatial pattern, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
notochord tbxta expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
endoderm foxa2 expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
pharyngeal endoderm absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
brain ventro-medial region foxa2 expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
prechordal plate gsc expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
germ ring dorsal region tbxta expression decreased amount, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 3 with image from Bisgrove et al., 2017
prechordal plate lft1 expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
spinal cord neuron tbx16 expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
margin ventral region eve1 expression decreased distribution, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
neuroectoderm ndr2 expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
germ ring tbxta expression spatial pattern, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 3 with image from Bisgrove et al., 2017
pharyngeal endoderm foxa2 expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
prechordal plate lft2 expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
central nervous system anterior region malformed, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 1 with image,  Fig. 3 with image from Bisgrove et al., 2017
eye fused with eye, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
whole organism morphology, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 3 with image from Bisgrove et al., 2017
neuroectoderm gsc expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
axial chorda mesoderm lft1 expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
axial mesoderm anterior region ndr2 expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
somite decreased size, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
axial chorda mesoderm tbxta expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
forerunner cell group sox17 expression decreased amount, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
neuroectoderm lft2 expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
hypoblast lft1 expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
notochord absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 1 with image,  Fig. 3 with image from Bisgrove et al., 2017
pharyngeal mesoderm hand2 expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
axial mesoderm posterior region ndr2 expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
heart tube hand2 expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
floor plate spinal cord region foxa2 expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
prechordal plate tbx16 expression decreased distribution, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
anterior neural plate otx2b expression decreased distribution, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
neuroectoderm lft1 expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
somite U-shaped, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
axial hypoblast foxa2 expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
pectoral fin bud hand2 expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 1 with image from Bisgrove et al., 2017
germ ring gsc expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 3 with image from Bisgrove et al., 2017
hypoblast tbx16 expression absent, abnormal gdf3zy52/zy52 (AB) standard conditions Fig. 2 with image from Bisgrove et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.