TALEN

TALEN1-fscn1a

ID

ZDB-TALEN-150526-1

Name

TALEN1-fscn1a

Previous Names

None

Target

fscn1a (1)

Target Sequence 1

5' - CGGCTTCAAGATCAATGCAT - 3'

Target Sequence 2

5' - CCAAATCTGCTTCTTCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genome Build: GRCz11Chromosome: 3

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zd1011	fscn1a
zd1012	fscn1a
zd1013	fscn1a

Expression

Gene expression in Wild Types + TALEN1-fscn1a

No data available

Phenotype

Phenotype resulting from TALEN1-fscn1a

No data available

Phenotype of all Fish created by or utilizing TALEN1-fscn1a

Phenotype	Fish	Conditions	Figures
sympathetic nervous system decreased size, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 7 from Boer et al., 2015
pharyngeal arch 1 morphology, abnormal	fscn1a^{zd1011/zd1011}	chemical treatment: pharmaceutical	Fig. 6 from Boer et al., 2015
palatoquadrate cartilage absent, abnormal	fscn1a^{zd1011/zd1011}	control	Fig. 5 , Fig. 6 from Boer et al., 2015
pharyngeal arch 1 cranial neural crest misrouted, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 4 from Boer et al., 2015
pharyngeal arch 1 neural crest cell migration process quality, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 4 from Boer et al., 2015
splanchnocranium morphology, abnormal	fscn1a^{zd1011/zd1011}	chemical treatment: pharmaceutical	Fig. 6 from Boer et al., 2015
splanchnocranium morphology, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 2 , Fig. 6 , Fig. 8 from Boer et al., 2015
cranial neural crest misrouted, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 4 from Boer et al., 2015
pharyngeal arch 1 absent, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 5 from Boer et al., 2015
Meckel's cartilage absent, abnormal	fscn1a^{zd1011/zd1011}	control	Fig. 5 , Fig. 6 from Boer et al., 2015
swim bladder morphology, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 2 from Boer et al., 2015
cranial neural crest neural crest cell migration process quality, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 4 from Boer et al., 2015
Meckel's cartilage absent, abnormal	fscn1a^{zd1011/zd1011}	chemical treatment: pharmaceutical	Fig. 6 from Boer et al., 2015
sympathetic nervous system malformed, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 7 from Boer et al., 2015
heart morphology, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 2 from Boer et al., 2015
sympathetic nervous system development process quality, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 7 , Fig. S9 from Boer et al., 2015
palatoquadrate cartilage absent, abnormal	fscn1a^{zd1011/zd1011}	chemical treatment: pharmaceutical	Fig. 6 from Boer et al., 2015
pharyngeal arch 1 morphology, abnormal	fscn1a^{zd1011/zd1011}	control	Fig. 5 , Fig. 6 from Boer et al., 2015
enteric neuron decreased amount, abnormal	fscn1a^{zd1011/zd1011}; w37Tg	standard conditions	Fig. 7 from Boer et al., 2015
sympathetic nervous system malformed, abnormal	fscn1a^{zd1011/zd1011}; zdf15Tg	standard conditions	Fig. 7 from Boer et al., 2015
sympathetic nervous system development process quality, abnormal	fscn1a^{zd1011/zd1011}; zdf15Tg	standard conditions	Fig. 7 from Boer et al., 2015
cranial neural crest filopodium decreased amount, abnormal	fscn1a^{zd1012/zd1012}; vu234Tg	control	Fig. 3 , Fig. 6 , Fig. 8 from Boer et al., 2015
cranial neural crest filopodium decreased length, abnormal	fscn1a^{zd1012/zd1012}; vu234Tg	chemical treatment: pharmaceutical	Fig. 6 from Boer et al., 2015
cranial neural crest filopodium decreased amount, abnormal	fscn1a^{zd1012/zd1012}; vu234Tg	chemical treatment: pharmaceutical	Fig. 6 from Boer et al., 2015
cranial neural crest filopodium decreased length, abnormal	fscn1a^{zd1012/zd1012}; vu234Tg	control	Fig. 3 , Fig. 6 , Fig. 8 from Boer et al., 2015
splanchnocranium morphology, abnormal	fscn1a^{zd1011/zd1011} + MO2-cxcr4a	standard conditions	Fig. 8 from Boer et al., 2015
sympathetic nervous system development process quality, abnormal	fscn1a^{zd1011/zd1011} + MO2-cxcr4a	standard conditions	Fig. S9 from Boer et al., 2015
cranial neural crest filopodium decreased amount, abnormal	fscn1a^{zd1012/zd1012}; vu234Tg + MO2-cxcr4a	standard conditions	Fig. 8 from Boer et al., 2015
cranial neural crest filopodium decreased length, abnormal	fscn1a^{zd1012/zd1012}; vu234Tg + MO2-cxcr4a	standard conditions	Fig. 8 from Boer et al., 2015

Citations

Include unpublished citations

Boer, E.F., Howell, E.D., Schilling, T.F., Jette, C.A., Stewart, R.A. (2015) Fascin1-Dependent Filopodia are Required for Directional Migration of a Subset of Neural Crest Cells. PLoS Genetics. 11:e1004946

1 - 1 of 1

Show