Morpholino

MO3-shox2

ID
ZDB-MRPHLNO-260701-1
Name
MO3-shox2
Previous Names
None
Target
Sequence
5' - AAGACATCACTGTTTTTCAGGGGTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-shox2
No data available
Phenotype
Phenotype resulting from MO3-shox2
Phenotype Fish Figures
head shox2 expression decreased amount, abnormal f1Tg + MO3-shox2 (AB/TU) Figure 1 with image from Hoffmann et al., 2026
head shox expression decreased amount, abnormal f1Tg + MO3-shox2 (AB/TU) Figure 1 with image from Hoffmann et al., 2026
head nppb expression increased amount, abnormal f1Tg + MO3-shox2 (AB/TU) Figure 2 with image from Hoffmann et al., 2026
head nppa expression increased amount, abnormal f1Tg + MO3-shox2 (AB/TU) Figure 2 with image from Hoffmann et al., 2026
heart shox2 expression decreased amount, abnormal f1Tg + MO3-shox2 (AB/TU) Figure 1 with image from Hoffmann et al., 2026
heart shox expression decreased amount, abnormal f1Tg + MO3-shox2 (AB/TU) Figure 1 with image from Hoffmann et al., 2026
heart nppb expression increased amount, abnormal f1Tg + MO3-shox2 (AB/TU) Figure 2 with image from Hoffmann et al., 2026
heart nppa expression increased amount, abnormal f1Tg + MO3-shox2 (AB/TU) Figure 2 with image from Hoffmann et al., 2026
pectoral fin shox2 expression decreased amount, abnormal f1Tg + MO3-shox2 (AB/TU) Figure 1 with image from Hoffmann et al., 2026
pectoral fin shox expression decreased amount, abnormal f1Tg + MO3-shox2 (AB/TU) Figure 1 with image from Hoffmann et al., 2026
pectoral fin fgfr3 expression increased amount, abnormal f1Tg + MO3-shox2 (AB/TU) Figure 3 with image from Hoffmann et al., 2026
pectoral fin nppb expression increased amount, abnormal f1Tg + MO3-shox2 (AB/TU) Figure 2 with image from Hoffmann et al., 2026
whole organism shox expression decreased amount, abnormal f1Tg + MO3-shox2 (AB/TU) Figure 1 with image from Hoffmann et al., 2026
whole organism shox2 expression decreased amount, abnormal f1Tg + MO3-shox2 (AB/TU) Figure 1 with image from Hoffmann et al., 2026
whole organism decreased length, abnormal AB/TU + MO3-shox2 Figure 3 with image from Hoffmann et al., 2026
whole organism fgfr3 expression increased amount, abnormal AB/TU + MO3-shox2 Figure 3 with image from Hoffmann et al., 2026
whole organism nppb expression increased amount, abnormal f1Tg + MO3-shox2 (AB/TU) Figure 2 with image from Hoffmann et al., 2026
Phenotype of all Fish created by or utilizing MO3-shox2
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal AB/TU + MO3-shox2 chemical treatment by environment: C-Type natriuretic peptide Figure 3 with image from Hoffmann et al., 2026
whole organism fgfr3 expression amount, ameliorated AB/TU + MO3-shox2 chemical treatment by environment: C-Type natriuretic peptide Figure 3 with image from Hoffmann et al., 2026
whole organism decreased length, abnormal AB/TU + MO3-shox2 control Figure 3 with image from Hoffmann et al., 2026
whole organism fgfr3 expression increased amount, abnormal AB/TU + MO3-shox2 control Figure 3 with image from Hoffmann et al., 2026
whole organism nppb expression decreased amount, abnormal AB/TU + MO3-shox2 chemical treatment by environment: C-Type natriuretic peptide Figure 3 with image from Hoffmann et al., 2026
head nppb expression increased amount, abnormal f1Tg + MO3-shox2 (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
whole organism shox expression decreased amount, abnormal f1Tg + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
whole organism fgfr3 expression increased amount, abnormal f1Tg + MO3-shox2 (AB/TU) control Figure 3 with image from Hoffmann et al., 2026
pectoral fin fgfr3 expression increased amount, abnormal f1Tg + MO3-shox2 (AB/TU) control Figure 3 with image from Hoffmann et al., 2026
head nppa expression increased amount, abnormal f1Tg + MO3-shox2 (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
pectoral fin shox2 expression decreased amount, abnormal f1Tg + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
head shox2 expression decreased amount, abnormal f1Tg + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
whole organism shox2 expression decreased amount, abnormal f1Tg + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
pectoral fin nppb expression increased amount, abnormal f1Tg + MO3-shox2 (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
heart nppa expression increased amount, abnormal f1Tg + MO3-shox2 (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
heart shox2 expression decreased amount, abnormal f1Tg + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
heart shox expression decreased amount, abnormal f1Tg + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
heart nppb expression increased amount, abnormal f1Tg + MO3-shox2 (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
head shox expression decreased amount, abnormal f1Tg + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
whole organism nppb expression increased amount, abnormal f1Tg + MO3-shox2 (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
pectoral fin shox expression decreased amount, abnormal f1Tg + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
whole organism shox expression decreased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
whole organism nppa expression increased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
whole organism fgfr3 expression increased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 3 with image from Hoffmann et al., 2026
pectoral fin fgfr3 expression increased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 3 with image from Hoffmann et al., 2026
pectoral fin nppc expression decreased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
head shox2 expression decreased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
pectoral fin shox2 expression decreased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
whole organism shox2 expression decreased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
heart shox2 expression decreased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
pectoral fin nppb expression increased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
head shox expression decreased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
heart nppb expression increased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
whole organism nppb expression increased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to report issues or recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.