Morpholino

MO3-gjb8

ID

ZDB-MRPHLNO-260406-3

Name

MO3-gjb8

Previous Names

None

Target

gjb8 (1)

Sequence

5' - TAAAGTGCTCCCCAACTCATCCTGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-gjb8

No data available

Phenotype

Phenotype resulting from MO3-gjb8

Phenotype	Fish	Figures
ball increased area, abnormal	AB + MO3-gjb8	Fig. 2 from Chen et al., 2026
lapillus decreased diameter, abnormal	AB + MO3-gjb8	Fig. 3 from Chen et al., 2026
neuromast hair cell decreased amount, abnormal	AB + MO3-gjb8	Fig. 4 from Chen et al., 2026
otic vesicle decreased diameter, abnormal	AB + MO3-gjb8	Fig. 3 from Chen et al., 2026
pericardium edematous, abnormal	AB + MO3-gjb8	Fig. 2 from Chen et al., 2026
post-vent region curved, abnormal	AB + MO3-gjb8	Fig. 2 from Chen et al., 2026
sagitta decreased diameter, abnormal	AB + MO3-gjb8	Fig. 3 from Chen et al., 2026
sagitta increased distance lapillus, abnormal	AB + MO3-gjb8	Fig. 3 from Chen et al., 2026
whole organism casp3a expression increased amount, abnormal	AB + MO3-gjb8	Fig. 6 from Chen et al., 2026
whole organism baxa expression increased amount, abnormal	AB + MO3-gjb8	Fig. 6 from Chen et al., 2026
whole organism ifi27.1 expression increased amount, abnormal	AB + MO3-gjb8	Fig. 6 from Chen et al., 2026
whole organism apaf1 expression increased amount, abnormal	AB + MO3-gjb8	Fig. 6 from Chen et al., 2026
whole organism casp9 expression increased amount, abnormal	AB + MO3-gjb8	Fig. 6 from Chen et al., 2026
whole organism ifi27.3 expression increased amount, abnormal	AB + MO3-gjb8	Fig. 6 from Chen et al., 2026
whole organism ifi27.4 expression increased amount, abnormal	AB + MO3-gjb8	Fig. 6 from Chen et al., 2026

Phenotype of all Fish created by or utilizing MO3-gjb8

Phenotype	Fish	Conditions	Figures
whole organism ifi27.1 expression increased amount, abnormal	AB + MO3-gjb8	control	Fig. 6 from Chen et al., 2026
sagitta decreased diameter, abnormal	AB + MO3-gjb8	control	Fig. 3 from Chen et al., 2026
whole organism casp9 expression increased amount, abnormal	AB + MO3-gjb8	control	Fig. 6 from Chen et al., 2026
lapillus decreased diameter, abnormal	AB + MO3-gjb8	control	Fig. 3 from Chen et al., 2026
whole organism ifi27.3 expression increased amount, abnormal	AB + MO3-gjb8	control	Fig. 6 from Chen et al., 2026
swimming behavior decreased process quality, abnormal	AB + MO3-gjb8	vibration	Fig. 5 from Chen et al., 2026
whole organism baxa expression increased amount, abnormal	AB + MO3-gjb8	control	Fig. 6 from Chen et al., 2026
ball increased area, abnormal	AB + MO3-gjb8	control	Fig. 2 from Chen et al., 2026
whole organism apaf1 expression increased amount, abnormal	AB + MO3-gjb8	control	Fig. 6 from Chen et al., 2026
whole organism ifi27.4 expression increased amount, abnormal	AB + MO3-gjb8	control	Fig. 6 from Chen et al., 2026
otic vesicle decreased diameter, abnormal	AB + MO3-gjb8	control	Fig. 3 from Chen et al., 2026
auditory behavior decreased process quality, abnormal	AB + MO3-gjb8	vibration	Fig. 5 from Chen et al., 2026
neuromast hair cell decreased amount, abnormal	AB + MO3-gjb8	control	Fig. 4 from Chen et al., 2026
sagitta increased distance lapillus, abnormal	AB + MO3-gjb8	control	Fig. 3 from Chen et al., 2026
pericardium edematous, abnormal	AB + MO3-gjb8	control	Fig. 2 from Chen et al., 2026
post-vent region curved, abnormal	AB + MO3-gjb8	control	Fig. 2 from Chen et al., 2026
whole organism casp3a expression increased amount, abnormal	AB + MO3-gjb8	control	Fig. 6 from Chen et al., 2026

Citations