Morpholino

MO2-lpin1a

ID
ZDB-MRPHLNO-210921-1
Name
MO2-lpin1a
Previous Names
None
Target
Sequence
5' - ATATTCTGTTTGTTCTGACCTGCTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-lpin1a
No data available
Phenotype
Phenotype resulting from MO2-lpin1a
Phenotype Fish Figures
hindbrain neurog1 expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
hindbrain lrp4 expression decreased amount, abnormal AB + MO2-lpin1a Figure S9 from Lu et al., 2021
midbrain neurog1 expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
motor neuron axon decreased distance motor neuron axon, abnormal AB + MO2-lpin1a Figure 4 with image from Lu et al., 2021
motor neuron axon guidance process quality, abnormal AB + MO2-lpin1a Figure 4 with image from Lu et al., 2021
myelination disrupted, abnormal ck1Tg + MO2-lpin1a Figure 5 with image from Lu et al., 2021
myotome shape, abnormal AB + MO2-lpin1a Figure 7 with imageFigure S9 from Lu et al., 2021
neuromuscular junction development disrupted, abnormal AB + MO2-lpin1a Figure 4 with image from Lu et al., 2021
oligodendrocyte differentiation disrupted, abnormal ck1Tg + MO2-lpin1a Figure 5 with image from Lu et al., 2021
pectoral fin lrp4 expression decreased amount, abnormal AB + MO2-lpin1a Figure S9 from Lu et al., 2021
primary motor neuron isl1a expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
primary motor neuron neuron projection decreased length, abnormal AB + MO2-lpin1a Figure 4 with image from Lu et al., 2021
Schwann cell differentiation disrupted, abnormal ck1Tg + MO2-lpin1a Figure 5 with image from Lu et al., 2021
secondary motor neuron branchiness, abnormal AB + MO2-lpin1a Figure 4 with image from Lu et al., 2021
secondary motor neuron axon decreased length, abnormal AB + MO2-lpin1a Figure 4 with image from Lu et al., 2021
segmental plate dlc expression increased distribution, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
skeletal muscle skeletal muscle myofibril disorganized, abnormal AB + MO2-lpin1a Figure 3 with image from Lu et al., 2021
skeletal muscle acetylcholine-gated channel clustering decreased occurrence, abnormal AB + MO2-lpin1a Figure 4 with image from Lu et al., 2021
somite dlc expression spatial pattern, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
spinal cord neurog1 expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
swimming decreased linear velocity, abnormal AB + MO2-lpin1a Figure 6 with image from Lu et al., 2021
swimming decreased process quality, abnormal AB + MO2-lpin1a Figure 6 with image from Lu et al., 2021
thigmotaxis decreased occurrence, abnormal AB + MO2-lpin1a Figure 6 with image from Lu et al., 2021
whole organism mpz expression decreased amount, abnormal AB + MO2-lpin1a Figure 5 with imageFigure 7 with image from Lu et al., 2021
whole organism pax2a expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
whole organism acta2 expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
whole organism axin2 expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
whole organism chrne expression decreased amount, abnormal AB + MO2-lpin1a Figure S6 from Lu et al., 2021
whole organism neurod1 expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
whole organism chrnb1 expression decreased amount, abnormal AB + MO2-lpin1a Figure S6 from Lu et al., 2021
whole organism mylpfa expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
whole organism lrp4 expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
whole organism egr2a expression decreased amount, abnormal ck1Tg + MO2-lpin1a Figure 5 with image from Lu et al., 2021
whole organism ache expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
whole organism chrna1 expression decreased amount, abnormal AB + MO2-lpin1a Figure S6 from Lu et al., 2021
whole organism egr2b expression decreased amount, abnormal ck1Tg + MO2-lpin1a Figure 5 with image from Lu et al., 2021
whole organism chrnb1l expression decreased amount, abnormal AB + MO2-lpin1a Figure S6 from Lu et al., 2021
whole organism egr1 expression decreased amount, abnormal ck1Tg + MO2-lpin1a Figure 5 with image from Lu et al., 2021
whole organism neurog1 expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
whole organism myog expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
whole organism decreased behavioural activity, abnormal AB + MO2-lpin1a Figure 6 with image from Lu et al., 2021
whole organism pou3f1 expression increased amount, abnormal ck1Tg + MO2-lpin1a Figure 5 with image from Lu et al., 2021
whole organism musk expression increased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
Phenotype of all Fish created by or utilizing MO2-lpin1a
Phenotype Fish Conditions Figures
primary motor neuron isl1a expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
skeletal muscle skeletal muscle myofibril disorganized, abnormal AB + MO2-lpin1a standard conditions Figure 3 with image from Lu et al., 2021
hindbrain lrp4 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure S9 from Lu et al., 2021
whole organism chrna1 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure S6 from Lu et al., 2021
whole organism chrne expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure S6 from Lu et al., 2021
secondary motor neuron branchiness, abnormal AB + MO2-lpin1a standard conditions Figure 4 with image from Lu et al., 2021
skeletal muscle acetylcholine-gated channel clustering decreased occurrence, abnormal AB + MO2-lpin1a standard conditions Figure 4 with image from Lu et al., 2021
myotome shape, abnormal AB + MO2-lpin1a standard conditions Figure 7 with imageFigure S9 from Lu et al., 2021
whole organism acta2 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
motor neuron axon guidance process quality, abnormal AB + MO2-lpin1a standard conditions Figure 4 with image from Lu et al., 2021
somite dlc expression spatial pattern, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism neurog1 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism myog expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
pectoral fin lrp4 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure S9 from Lu et al., 2021
hindbrain neurog1 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
swimming decreased process quality, abnormal AB + MO2-lpin1a standard conditions Figure 6 with image from Lu et al., 2021
segmental plate dlc expression increased distribution, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism pax2a expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism neurod1 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism mpz expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism musk expression increased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
thigmotaxis decreased occurrence, abnormal AB + MO2-lpin1a standard conditions Figure 6 with image from Lu et al., 2021
whole organism chrnb1l expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure S6 from Lu et al., 2021
secondary motor neuron axon decreased length, abnormal AB + MO2-lpin1a standard conditions Figure 4 with image from Lu et al., 2021
motor neuron axon decreased distance motor neuron axon, abnormal AB + MO2-lpin1a standard conditions Figure 4 with image from Lu et al., 2021
neuromuscular junction development disrupted, abnormal AB + MO2-lpin1a standard conditions Figure 4 with image from Lu et al., 2021
swimming decreased linear velocity, abnormal AB + MO2-lpin1a standard conditions Figure 6 with image from Lu et al., 2021
primary motor neuron neuron projection decreased length, abnormal AB + MO2-lpin1a standard conditions Figure 4 with image from Lu et al., 2021
whole organism axin2 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
midbrain neurog1 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism mylpfa expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
spinal cord neurog1 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism chrnb1 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure S6 from Lu et al., 2021
whole organism ache expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism decreased behavioural activity, abnormal AB + MO2-lpin1a standard conditions Figure 6 with image from Lu et al., 2021
whole organism lrp4 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism mpz expression decreased amount, abnormal ck1Tg + MO2-lpin1a standard conditions Figure 5 with image from Lu et al., 2021
whole organism pou3f1 expression increased amount, abnormal ck1Tg + MO2-lpin1a standard conditions Figure 5 with image from Lu et al., 2021
whole organism egr2a expression decreased amount, abnormal ck1Tg + MO2-lpin1a standard conditions Figure 5 with image from Lu et al., 2021
Schwann cell differentiation disrupted, abnormal ck1Tg + MO2-lpin1a standard conditions Figure 5 with image from Lu et al., 2021
myelination disrupted, abnormal ck1Tg + MO2-lpin1a standard conditions Figure 5 with image from Lu et al., 2021
whole organism egr2b expression decreased amount, abnormal ck1Tg + MO2-lpin1a standard conditions Figure 5 with image from Lu et al., 2021
whole organism egr1 expression decreased amount, abnormal ck1Tg + MO2-lpin1a standard conditions Figure 5 with image from Lu et al., 2021
oligodendrocyte differentiation disrupted, abnormal ck1Tg + MO2-lpin1a standard conditions Figure 5 with image from Lu et al., 2021
Citations