Morpholino

MO2-lpin1a

ID
ZDB-MRPHLNO-210921-1
Name
MO2-lpin1a
Previous Names
None
Target
Sequence
5' - ATATTCTGTTTGTTCTGACCTGCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-lpin1a
No data available
Phenotype
Phenotype resulting from MO2-lpin1a
Phenotype Fish Figures
hindbrain neurog1 expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
hindbrain lrp4 expression decreased amount, abnormal AB + MO2-lpin1a Figure S9 from Lu et al., 2021
midbrain neurog1 expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
motor neuron axon decreased distance motor neuron axon, abnormal AB + MO2-lpin1a Figure 4 with image from Lu et al., 2021
motor neuron axon guidance process quality, abnormal AB + MO2-lpin1a Figure 4 with image from Lu et al., 2021
myelination disrupted, abnormal ck1Tg + MO2-lpin1a Figure 5 with image from Lu et al., 2021
myotome shape, abnormal AB + MO2-lpin1a Figure 7 with image,  Figure S9 from Lu et al., 2021
neuromuscular junction development disrupted, abnormal AB + MO2-lpin1a Figure 4 with image from Lu et al., 2021
oligodendrocyte differentiation disrupted, abnormal ck1Tg + MO2-lpin1a Figure 5 with image from Lu et al., 2021
pectoral fin lrp4 expression decreased amount, abnormal AB + MO2-lpin1a Figure S9 from Lu et al., 2021
primary motor neuron isl1a expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
primary motor neuron neuron projection decreased length, abnormal AB + MO2-lpin1a Figure 4 with image from Lu et al., 2021
Schwann cell differentiation disrupted, abnormal ck1Tg + MO2-lpin1a Figure 5 with image from Lu et al., 2021
secondary motor neuron branchiness, abnormal AB + MO2-lpin1a Figure 4 with image from Lu et al., 2021
secondary motor neuron axon decreased length, abnormal AB + MO2-lpin1a Figure 4 with image from Lu et al., 2021
segmental plate dlc expression increased distribution, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
skeletal muscle skeletal muscle myofibril disorganized, abnormal AB + MO2-lpin1a Figure 3 with image from Lu et al., 2021
skeletal muscle acetylcholine-gated channel clustering decreased occurrence, abnormal AB + MO2-lpin1a Figure 4 with image from Lu et al., 2021
somite dlc expression spatial pattern, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
spinal cord neurog1 expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
swimming decreased linear velocity, abnormal AB + MO2-lpin1a Figure 6 with image from Lu et al., 2021
swimming decreased process quality, abnormal AB + MO2-lpin1a Figure 6 with image from Lu et al., 2021
thigmotaxis decreased occurrence, abnormal AB + MO2-lpin1a Figure 6 with image from Lu et al., 2021
whole organism mpz expression decreased amount, abnormal ck1Tg + MO2-lpin1a Figure 5 with image,  Figure 7 with image from Lu et al., 2021
whole organism pax2a expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
whole organism acta2 expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
whole organism axin2 expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
whole organism chrne expression decreased amount, abnormal AB + MO2-lpin1a Figure S6 from Lu et al., 2021
whole organism neurod1 expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
whole organism chrnb1 expression decreased amount, abnormal AB + MO2-lpin1a Figure S6 from Lu et al., 2021
whole organism mylpfa expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
whole organism lrp4 expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
whole organism egr2a expression decreased amount, abnormal ck1Tg + MO2-lpin1a Figure 5 with image from Lu et al., 2021
whole organism chrna1 expression decreased amount, abnormal AB + MO2-lpin1a Figure S6 from Lu et al., 2021
whole organism ache expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
whole organism egr2b expression decreased amount, abnormal ck1Tg + MO2-lpin1a Figure 5 with image from Lu et al., 2021
whole organism chrnb1l expression decreased amount, abnormal AB + MO2-lpin1a Figure S6 from Lu et al., 2021
whole organism egr1 expression decreased amount, abnormal ck1Tg + MO2-lpin1a Figure 5 with image from Lu et al., 2021
whole organism neurog1 expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
whole organism myog expression decreased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
whole organism decreased behavioural activity, abnormal AB + MO2-lpin1a Figure 6 with image from Lu et al., 2021
whole organism pou3f1 expression increased amount, abnormal ck1Tg + MO2-lpin1a Figure 5 with image from Lu et al., 2021
whole organism musk expression increased amount, abnormal AB + MO2-lpin1a Figure 7 with image from Lu et al., 2021
Phenotype of all Fish created by or utilizing MO2-lpin1a
Phenotype Fish Conditions Figures
primary motor neuron isl1a expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
skeletal muscle skeletal muscle myofibril disorganized, abnormal AB + MO2-lpin1a standard conditions Figure 3 with image from Lu et al., 2021
hindbrain lrp4 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure S9 from Lu et al., 2021
whole organism chrna1 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure S6 from Lu et al., 2021
whole organism chrne expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure S6 from Lu et al., 2021
secondary motor neuron branchiness, abnormal AB + MO2-lpin1a standard conditions Figure 4 with image from Lu et al., 2021
skeletal muscle acetylcholine-gated channel clustering decreased occurrence, abnormal AB + MO2-lpin1a standard conditions Figure 4 with image from Lu et al., 2021
myotome shape, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image,  Figure S9 from Lu et al., 2021
whole organism acta2 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
motor neuron axon guidance process quality, abnormal AB + MO2-lpin1a standard conditions Figure 4 with image from Lu et al., 2021
somite dlc expression spatial pattern, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism neurog1 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism myog expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
pectoral fin lrp4 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure S9 from Lu et al., 2021
hindbrain neurog1 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
swimming decreased process quality, abnormal AB + MO2-lpin1a standard conditions Figure 6 with image from Lu et al., 2021
segmental plate dlc expression increased distribution, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism pax2a expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism neurod1 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism mpz expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism musk expression increased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
thigmotaxis decreased occurrence, abnormal AB + MO2-lpin1a standard conditions Figure 6 with image from Lu et al., 2021
whole organism chrnb1l expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure S6 from Lu et al., 2021
secondary motor neuron axon decreased length, abnormal AB + MO2-lpin1a standard conditions Figure 4 with image from Lu et al., 2021
motor neuron axon decreased distance motor neuron axon, abnormal AB + MO2-lpin1a standard conditions Figure 4 with image from Lu et al., 2021
neuromuscular junction development disrupted, abnormal AB + MO2-lpin1a standard conditions Figure 4 with image from Lu et al., 2021
swimming decreased linear velocity, abnormal AB + MO2-lpin1a standard conditions Figure 6 with image from Lu et al., 2021
primary motor neuron neuron projection decreased length, abnormal AB + MO2-lpin1a standard conditions Figure 4 with image from Lu et al., 2021
whole organism axin2 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
midbrain neurog1 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism mylpfa expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
spinal cord neurog1 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism chrnb1 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure S6 from Lu et al., 2021
whole organism ache expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism decreased behavioural activity, abnormal AB + MO2-lpin1a standard conditions Figure 6 with image from Lu et al., 2021
whole organism lrp4 expression decreased amount, abnormal AB + MO2-lpin1a standard conditions Figure 7 with image from Lu et al., 2021
whole organism mpz expression decreased amount, abnormal ck1Tg + MO2-lpin1a standard conditions Figure 5 with image from Lu et al., 2021
whole organism pou3f1 expression increased amount, abnormal ck1Tg + MO2-lpin1a standard conditions Figure 5 with image from Lu et al., 2021
whole organism egr2a expression decreased amount, abnormal ck1Tg + MO2-lpin1a standard conditions Figure 5 with image from Lu et al., 2021
Schwann cell differentiation disrupted, abnormal ck1Tg + MO2-lpin1a standard conditions Figure 5 with image from Lu et al., 2021
myelination disrupted, abnormal ck1Tg + MO2-lpin1a standard conditions Figure 5 with image from Lu et al., 2021
whole organism egr2b expression decreased amount, abnormal ck1Tg + MO2-lpin1a standard conditions Figure 5 with image from Lu et al., 2021
whole organism egr1 expression decreased amount, abnormal ck1Tg + MO2-lpin1a standard conditions Figure 5 with image from Lu et al., 2021
oligodendrocyte differentiation disrupted, abnormal ck1Tg + MO2-lpin1a standard conditions Figure 5 with image from Lu et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.