Morpholino

MO3-ybx1

ID
ZDB-MRPHLNO-200317-3
Name
MO3-ybx1
Previous Names
None
Target
Sequence
5' - GTGGCTCTCTAGTGTGTTTTCCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ybx1
No data available
Phenotype
Phenotype resulting from MO3-ybx1
Phenotype of all Fish created by or utilizing MO3-ybx1
Phenotype Fish Conditions Figures
embryonic structure slc9d1 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. S4 from Yang et al., 2019
embryonic structure hic1 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. S4 from Yang et al., 2019
somitogenesis delayed, abnormal AB + MO3-ybx1 standard conditions Fig. 5 with imageFig. S3 with image from Yang et al., 2019
embryonic structure galnt6 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. S4 from Yang et al., 2019
embryonic structure tacc3 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. S4 from Yang et al., 2019
embryonic structure cap1 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. 5 with imageFig. S4 from Yang et al., 2019
embryonic structure ncoa6 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. S4 from Yang et al., 2019
gastrulation delayed, abnormal AB + MO3-ybx1 standard conditions Fig. 3 with imageFig. 5 with imageFig. S3 with image from Yang et al., 2019
embryonic structure tpp2 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. 5 with imageFig. S4 from Yang et al., 2019
embryonic structure tex2 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. S4 from Yang et al., 2019
embryonic structure map7d3 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. S4 from Yang et al., 2019
embryonic structure stard8 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. S4 from Yang et al., 2019
gastrulation increased duration, abnormal AB + MO3-ybx1 standard conditions Fig. 5 with imageFig. S3 with image from Yang et al., 2019
somitogenesis delayed, abnormal AB + MO1-pabpc1a + MO3-ybx1 standard conditions Fig. 5 with image from Yang et al., 2019
gastrulation delayed, abnormal AB + MO1-pabpc1a + MO3-ybx1 standard conditions Fig. 5 with image from Yang et al., 2019
embryonic structure cap1 expression decreased amount, abnormal AB + MO1-pabpc1a + MO3-ybx1 standard conditions Fig. 5 with image from Yang et al., 2019
embryonic structure tpp2 expression amount, ameliorated AB + MO1-pabpc1a + MO3-ybx1 standard conditions Fig. 5 with image from Yang et al., 2019
embryonic structure tex2 expression decreased amount, abnormal AB + MO1-pabpc1a + MO3-ybx1 standard conditions Fig. 5 with image from Yang et al., 2019
gastrulation increased duration, abnormal AB + MO1-pabpc1a + MO3-ybx1 standard conditions Fig. 5 with image from Yang et al., 2019
Citations