Morpholino

MO3-ybx1

ID
ZDB-MRPHLNO-200317-3
Name
MO3-ybx1
Previous Names
None
Target
Sequence
5' - GTGGCTCTCTAGTGTGTTTTCCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ybx1
Expressed Gene Anatomy Figures
cap1 Fig. 5 with image,  Fig. S4 from Yang et al., 2019
galnt6 Fig. S4 from Yang et al., 2019
hic1 Fig. S4 from Yang et al., 2019
map7d3 Fig. S4 from Yang et al., 2019
ncoa6 Fig. S4 from Yang et al., 2019
stard8 Fig. S4 from Yang et al., 2019
tacc3 Fig. S4 from Yang et al., 2019
tex2 Fig. S4 from Yang et al., 2019
tmco3 Fig. S4 from Yang et al., 2019
tpp2 Fig. 5 with image,  Fig. S4 from Yang et al., 2019
Phenotype
Phenotype resulting from MO3-ybx1
Phenotype Fish Figures
embryonic structure tex2 expression decreased amount, abnormal AB + MO3-ybx1 Fig. S4 from Yang et al., 2019
embryonic structure stard8 expression decreased amount, abnormal AB + MO3-ybx1 Fig. S4 from Yang et al., 2019
embryonic structure map7d3 expression decreased amount, abnormal AB + MO3-ybx1 Fig. S4 from Yang et al., 2019
embryonic structure tmco3 expression decreased amount, abnormal AB + MO3-ybx1 Fig. S4 from Yang et al., 2019
embryonic structure hic1 expression decreased amount, abnormal AB + MO3-ybx1 Fig. S4 from Yang et al., 2019
embryonic structure galnt6 expression decreased amount, abnormal AB + MO3-ybx1 Fig. S4 from Yang et al., 2019
embryonic structure tpp2 expression decreased amount, abnormal AB + MO3-ybx1 Fig. 5 with image,  Fig. S4 from Yang et al., 2019
embryonic structure ncoa6 expression decreased amount, abnormal AB + MO3-ybx1 Fig. S4 from Yang et al., 2019
embryonic structure tacc3 expression decreased amount, abnormal AB + MO3-ybx1 Fig. S4 from Yang et al., 2019
embryonic structure cap1 expression decreased amount, abnormal AB + MO3-ybx1 Fig. 5 with image,  Fig. S4 from Yang et al., 2019
gastrulation delayed, abnormal AB + MO3-ybx1 Fig. 3 with image,  Fig. 5 with image,  Fig. S3 with image from Yang et al., 2019
gastrulation increased duration, abnormal AB + MO3-ybx1 Fig. 5 with image,  Fig. S3 with image from Yang et al., 2019
somitogenesis delayed, abnormal AB + MO3-ybx1 Fig. 5 with image,  Fig. S3 with image from Yang et al., 2019
Phenotype of all Fish created by or utilizing MO3-ybx1
Phenotype Fish Conditions Figures
embryonic structure tmco3 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. S4 from Yang et al., 2019
embryonic structure hic1 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. S4 from Yang et al., 2019
somitogenesis delayed, abnormal AB + MO3-ybx1 standard conditions Fig. 5 with image,  Fig. S3 with image from Yang et al., 2019
embryonic structure galnt6 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. S4 from Yang et al., 2019
embryonic structure tacc3 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. S4 from Yang et al., 2019
embryonic structure cap1 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. 5 with image,  Fig. S4 from Yang et al., 2019
embryonic structure ncoa6 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. S4 from Yang et al., 2019
gastrulation delayed, abnormal AB + MO3-ybx1 standard conditions Fig. 3 with image,  Fig. 5 with image,  Fig. S3 with image from Yang et al., 2019
embryonic structure tpp2 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. 5 with image,  Fig. S4 from Yang et al., 2019
embryonic structure tex2 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. S4 from Yang et al., 2019
embryonic structure map7d3 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. S4 from Yang et al., 2019
embryonic structure stard8 expression decreased amount, abnormal AB + MO3-ybx1 standard conditions Fig. S4 from Yang et al., 2019
gastrulation increased duration, abnormal AB + MO3-ybx1 standard conditions Fig. 5 with image,  Fig. S3 with image from Yang et al., 2019
somitogenesis delayed, abnormal AB + MO1-pabpc1a + MO3-ybx1 standard conditions Fig. 5 with image from Yang et al., 2019
gastrulation delayed, abnormal AB + MO1-pabpc1a + MO3-ybx1 standard conditions Fig. 5 with image from Yang et al., 2019
embryonic structure cap1 expression decreased amount, abnormal AB + MO1-pabpc1a + MO3-ybx1 standard conditions Fig. 5 with image from Yang et al., 2019
embryonic structure tpp2 expression amount, ameliorated AB + MO1-pabpc1a + MO3-ybx1 standard conditions Fig. 5 with image from Yang et al., 2019
embryonic structure tex2 expression decreased amount, abnormal AB + MO1-pabpc1a + MO3-ybx1 standard conditions Fig. 5 with image from Yang et al., 2019
gastrulation increased duration, abnormal AB + MO1-pabpc1a + MO3-ybx1 standard conditions Fig. 5 with image from Yang et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.