Morpholino

MO1-tubg1

ID

ZDB-MRPHLNO-190422-3

Name

MO1-tubg1

Previous Names

None

Target

Sequence

5' - GAATAACAGCAGGACGGGATGCCTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tubg1

No data available

Phenotype

Phenotype resulting from MO1-tubg1

Phenotype	Fish	Figures
blastomere has extra parts of type blastomere nucleus, abnormal	WT + MO1-tubg1	Fig. 4 from Pouchucq et al., 2018
blastomere apoptotic process increased occurrence, abnormal	WT + MO1-tubg1	Fig. 5 from Pouchucq et al., 2018
blastomere cell population proliferation arrested, abnormal	WT + MO1-tubg1	Fig. 5 from Pouchucq et al., 2018
blastomere cytoplasm ab1-tubg1 labeling mislocalised, abnormal	WT + MO1-tubg1	Fig. 4 from Pouchucq et al., 2018
blastomere gamma-tubulin small complex absent, abnormal	WT + MO1-tubg1	Fig. 3 from Pouchucq et al., 2018
blastomere perinuclear region of cytoplasm ab1-tubg1 labeling mislocalised, abnormal	WT + MO1-tubg1	Fig. 4 from Pouchucq et al., 2018
cell cycle process quality, abnormal	WT + MO1-tubg1	Fig. 4 from Pouchucq et al., 2018
embryo development arrested, abnormal	WT + MO1-tubg1	Fig. 2 from Pouchucq et al., 2018
microtubule cytoskeleton organization process quality, abnormal	WT + MO1-tubg1	Fig. 3, Fig. 4 from Pouchucq et al., 2018
whole organism morphology, abnormal	WT + MO1-tubg1	Fig. 2 from Pouchucq et al., 2018
whole organism cytoplasm ab1-tubg1 labeling decreased amount, abnormal	WT + MO1-tubg1	Fig. 3 from Pouchucq et al., 2018

Phenotype of all Fish created by or utilizing MO1-tubg1

Phenotype	Fish	Conditions	Figures
whole organism cytoplasm ab1-tubg1 labeling decreased amount, abnormal	WT + MO1-tubg1	standard conditions	Fig. 3 from Pouchucq et al., 2018
blastomere cytoplasm ab1-tubg1 labeling mislocalised, abnormal	WT + MO1-tubg1	standard conditions	Fig. 4 from Pouchucq et al., 2018
microtubule cytoskeleton organization process quality, abnormal	WT + MO1-tubg1	standard conditions	Fig. 3, Fig. 4 from Pouchucq et al., 2018
blastomere gamma-tubulin small complex absent, abnormal	WT + MO1-tubg1	standard conditions	Fig. 3 from Pouchucq et al., 2018
whole organism morphology, abnormal	WT + MO1-tubg1	standard conditions	Fig. 2 from Pouchucq et al., 2018
blastomere has extra parts of type blastomere nucleus, abnormal	WT + MO1-tubg1	standard conditions	Fig. 4 from Pouchucq et al., 2018
embryo development arrested, abnormal	WT + MO1-tubg1	standard conditions	Fig. 2 from Pouchucq et al., 2018
blastomere perinuclear region of cytoplasm ab1-tubg1 labeling mislocalised, abnormal	WT + MO1-tubg1	standard conditions	Fig. 4 from Pouchucq et al., 2018
cell cycle process quality, abnormal	WT + MO1-tubg1	standard conditions	Fig. 4 from Pouchucq et al., 2018
blastomere cell population proliferation arrested, abnormal	WT + MO1-tubg1	standard conditions	Fig. 5 from Pouchucq et al., 2018
blastomere apoptotic process increased occurrence, abnormal	WT + MO1-tubg1	standard conditions	Fig. 5 from Pouchucq et al., 2018

Citations