Morpholino

MO2-ybx1

ID
ZDB-MRPHLNO-190124-2
Name
MO2-ybx1
Previous Names
None
Target
Sequence
5' - CGGCCTCGCTGCTCATGTTGTTTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ybx1
Phenotype
Phenotype resulting from MO2-ybx1
Phenotype Fish Figures
epiboly involved in gastrulation with mouth forming second arrested, abnormal TU + MO2-ybx1 Fig. 3 with image from Sun et al., 2018
epiboly involved in gastrulation with mouth forming second onset quality, abnormal TU + MO2-ybx1 Fig. 3 with image from Sun et al., 2018
translation increased occurrence, abnormal TU + MO2-ybx1 Fig. 5 with image from Sun et al., 2018
whole organism nnr expression decreased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism vent expression decreased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism grhl3 expression decreased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism fgfr4 expression decreased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism wnt11f2 expression decreased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism cxcr4b expression decreased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism apoeb expression decreased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism dusp6 expression decreased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism cd82b expression increased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism btg4 expression increased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism atf3 expression increased amount, abnormal TU + MO2-ybx1 Fig. 6 from Sun et al., 2018
whole organism lipg expression increased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism ripor3 expression increased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism cldnd expression increased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism acadl expression increased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism slc35f2 expression increased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism casd1 expression increased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
Phenotype of all Fish created by or utilizing MO2-ybx1
Phenotype Fish Conditions Figures
whole organism nnr expression decreased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism slc35f2 expression increased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism cxcr4b expression decreased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
translation increased occurrence, abnormal TU + MO2-ybx1 control Fig. 5 with image from Sun et al., 2018
whole organism grhl3 expression decreased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism atf3 expression increased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 6 from Sun et al., 2018
whole organism apoeb expression decreased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism fgfr4 expression decreased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
epiboly involved in gastrulation with mouth forming second arrested, abnormal TU + MO2-ybx1 standard conditions Fig. 3 with image from Sun et al., 2018
whole organism acadl expression increased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism lipg expression increased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism wnt11f2 expression decreased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism cd82b expression increased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism ripor3 expression increased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
epiboly involved in gastrulation with mouth forming second onset quality, abnormal TU + MO2-ybx1 standard conditions Fig. 3 with image from Sun et al., 2018
whole organism dusp6 expression decreased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism cldnd expression increased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism vent expression decreased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism btg4 expression increased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism casd1 expression increased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
epiboly involved in gastrulation with mouth forming second onset quality, ameliorated tsu29Tg + MO2-ybx1(TU) standard conditions Fig. 3 with image from Sun et al., 2018
epiboly involved in gastrulation with mouth forming second occurrence, ameliorated tsu29Tg + MO2-ybx1(TU) standard conditions Fig. 3 with image from Sun et al., 2018
Citations