Morpholino

MO2-ybx1

ID
ZDB-MRPHLNO-190124-2
Name
MO2-ybx1
Previous Names
None
Target
Sequence
5' - CGGCCTCGCTGCTCATGTTGTTTTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ybx1
Expressed Gene Anatomy Figures
acadl Fig. 4 from Sun et al., 2018
apoeb Fig. 4 from Sun et al., 2018
atf3 Fig. 6 from Sun et al., 2018
btg4 Fig. 4 from Sun et al., 2018
casd1 Fig. 4 from Sun et al., 2018
cd82b Fig. 4 from Sun et al., 2018
cldnd Fig. 4 from Sun et al., 2018
cxcr4b Fig. 4 from Sun et al., 2018
dusp6 Fig. 4 from Sun et al., 2018
fgfr4 Fig. 4 from Sun et al., 2018
grhl3 Fig. 4 from Sun et al., 2018
lipg Fig. 4 from Sun et al., 2018
nnr Fig. 4 from Sun et al., 2018
ripor3 Fig. 4 from Sun et al., 2018
slc35f2 Fig. 4 from Sun et al., 2018
vent Fig. 4 from Sun et al., 2018
wnt11f2 Fig. 4 from Sun et al., 2018
Phenotype
Phenotype resulting from MO2-ybx1
Phenotype Fish Figures
epiboly involved in gastrulation with mouth forming second arrested, abnormal TU + MO2-ybx1 Fig. 3 with image from Sun et al., 2018
epiboly involved in gastrulation with mouth forming second onset quality, abnormal TU + MO2-ybx1 Fig. 3 with image from Sun et al., 2018
translation increased occurrence, abnormal TU + MO2-ybx1 Fig. 5 with image from Sun et al., 2018
whole organism nnr expression decreased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism vent expression decreased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism fgfr4 expression decreased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism grhl3 expression decreased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism wnt11f2 expression decreased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism cxcr4b expression decreased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism apoeb expression decreased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism dusp6 expression decreased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism cd82b expression increased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism btg4 expression increased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism atf3 expression increased amount, abnormal TU + MO2-ybx1 Fig. 6 from Sun et al., 2018
whole organism lipg expression increased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism cldnd expression increased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism ripor3 expression increased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism acadl expression increased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism slc35f2 expression increased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
whole organism casd1 expression increased amount, abnormal TU + MO2-ybx1 Fig. 4 from Sun et al., 2018
Phenotype of all Fish created by or utilizing MO2-ybx1
Phenotype Fish Conditions Figures
whole organism nnr expression decreased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism slc35f2 expression increased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism cxcr4b expression decreased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
translation increased occurrence, abnormal TU + MO2-ybx1 control Fig. 5 with image from Sun et al., 2018
whole organism grhl3 expression decreased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism atf3 expression increased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 6 from Sun et al., 2018
whole organism apoeb expression decreased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism fgfr4 expression decreased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
epiboly involved in gastrulation with mouth forming second arrested, abnormal TU + MO2-ybx1 standard conditions Fig. 3 with image from Sun et al., 2018
whole organism acadl expression increased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism lipg expression increased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism wnt11f2 expression decreased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism cd82b expression increased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism ripor3 expression increased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
epiboly involved in gastrulation with mouth forming second onset quality, abnormal TU + MO2-ybx1 standard conditions Fig. 3 with image from Sun et al., 2018
whole organism dusp6 expression decreased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism cldnd expression increased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism vent expression decreased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism btg4 expression increased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
whole organism casd1 expression increased amount, abnormal TU + MO2-ybx1 standard conditions Fig. 4 from Sun et al., 2018
epiboly involved in gastrulation with mouth forming second onset quality, ameliorated tsu29Tg + MO2-ybx1 (TU) standard conditions Fig. 3 with image from Sun et al., 2018
epiboly involved in gastrulation with mouth forming second occurrence, ameliorated tsu29Tg + MO2-ybx1 (TU) standard conditions Fig. 3 with image from Sun et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.