Morpholino

MO2-ftr82

ID
ZDB-MRPHLNO-180108-2
Name
MO2-ftr82
Previous Names
None
Target
Sequence
5' - GCGCTATGTTTTCCTTACCTGTTTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ftr82
No data available
Phenotype
Phenotype resulting from MO2-ftr82
Phenotype Fish Figures
angiogenesis disrupted, abnormal la116Tg + MO2-ftr82 Fig. 2 with image from Chang et al., 2017
artery efnb2a expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
blood increased accumulation caudal vein plexus, abnormal y1Tg + MO2-ftr82 Fig. 3 with image from Chang et al., 2017
blood circulation disrupted, abnormal y1Tg + MO2-ftr82 Fig. 3 with image from Chang et al., 2017
blood vessel development decreased process quality, abnormal la116Tg + MO2-ftr82 Fig. 2 with image from Chang et al., 2017
brain edematous, abnormal y1Tg + MO2-ftr82 Fig. 3 with image from Chang et al., 2017
caudal vein plexus flt4 expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
caudal vein plexus mrc1a expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
caudal vein plexus morphology, abnormal la116Tg + MO2-ftr82 Fig. 2 with image from Chang et al., 2017
caudal vein plexus sprouting angiogenesis decreased occurrence, abnormal la116Tg + MO2-ftr82 Fig. 2 with image from Chang et al., 2017
endothelial cell migration disrupted, abnormal la116Tg + MO2-ftr82 Fig. 5 with image from Chang et al., 2017
epidermis apoptotic process increased occurrence, abnormal WT + MO2-ftr82 Fig. 5 with image from Chang et al., 2017
intersegmental vessel flt4 expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
intersegmental vessel decreased length, abnormal y1Tg + MO2-ftr82 Fig. 2 with imageFig. 3 with imageFig. 4 with imageFig. 5 with image from Chang et al., 2017
intersegmental vessel morphology, abnormal y1Tg + MO2-ftr82 Fig. 2 with imageFig. 3 with imageFig. 4 with imageFig. 5 with image from Chang et al., 2017
intersegmental vessel endothelial cell decreased amount, abnormal ci5Tg; y7Tg + MO2-ftr82 Fig. 5 with image from Chang et al., 2017
lymphangioblast cord absent, abnormal y1Tg + MO2-ftr82 Fig. 3 with image from Chang et al., 2017
pericardium edematous, abnormal y1Tg + MO2-ftr82 Fig. 3 with image from Chang et al., 2017
posterior cardinal vein flt4 expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
posterior cardinal vein mrc1a expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
vasculature kdrl expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
vasculature stab2 expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
whole organism kdrl expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
whole organism efnb2a expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
whole organism flt4 expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
whole organism mrc1a expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
whole organism ftr82 expression decreased amount, abnormal la116Tg + MO2-ftr82 Fig. 2 with image from Chang et al., 2017
Phenotype of all Fish created by or utilizing MO2-ftr82
Phenotype Fish Conditions Figures
caudal vein plexus flt4 expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
epidermis apoptotic process increased occurrence, abnormal WT + MO2-ftr82 standard conditions Fig. 5 with image from Chang et al., 2017
whole organism mrc1a expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
posterior cardinal vein flt4 expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
whole organism efnb2a expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
vasculature stab2 expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
intersegmental vessel flt4 expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
whole organism kdrl expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
vasculature kdrl expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
whole organism flt4 expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
posterior cardinal vein mrc1a expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
artery efnb2a expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
caudal vein plexus mrc1a expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
intersegmental vessel morphology, abnormal la116Tg + MO2-ftr82 standard conditions Fig. 2 with imageFig. 5 with image from Chang et al., 2017
endothelial cell migration disrupted, abnormal la116Tg + MO2-ftr82 standard conditions Fig. 5 with image from Chang et al., 2017
angiogenesis disrupted, abnormal la116Tg + MO2-ftr82 standard conditions Fig. 2 with image from Chang et al., 2017
whole organism ftr82 expression decreased amount, abnormal la116Tg + MO2-ftr82 standard conditions Fig. 2 with image from Chang et al., 2017
intersegmental vessel decreased length, abnormal la116Tg + MO2-ftr82 standard conditions Fig. 2 with imageFig. 5 with image from Chang et al., 2017
blood vessel development decreased process quality, abnormal la116Tg + MO2-ftr82 standard conditions Fig. 2 with image from Chang et al., 2017
caudal vein plexus morphology, abnormal la116Tg + MO2-ftr82 standard conditions Fig. 2 with image from Chang et al., 2017
caudal vein plexus sprouting angiogenesis decreased occurrence, abnormal la116Tg + MO2-ftr82 standard conditions Fig. 2 with image from Chang et al., 2017
intersegmental vessel morphology, abnormal y1Tg + MO2-ftr82 standard conditions Fig. 3 with imageFig. 4 with image from Chang et al., 2017
blood increased accumulation caudal vein plexus, abnormal y1Tg + MO2-ftr82 standard conditions Fig. 3 with image from Chang et al., 2017
intersegmental vessel decreased length, abnormal y1Tg + MO2-ftr82 standard conditions Fig. 3 with imageFig. 4 with image from Chang et al., 2017
lymphangioblast cord absent, abnormal y1Tg + MO2-ftr82 standard conditions Fig. 3 with image from Chang et al., 2017
blood circulation disrupted, abnormal y1Tg + MO2-ftr82 standard conditions Fig. 3 with image from Chang et al., 2017
brain edematous, abnormal y1Tg + MO2-ftr82 standard conditions Fig. 3 with image from Chang et al., 2017
pericardium edematous, abnormal y1Tg + MO2-ftr82 standard conditions Fig. 3 with image from Chang et al., 2017
intersegmental vessel morphology, abnormal ci5Tg; y7Tg + MO2-ftr82 standard conditions Fig. 5 with image from Chang et al., 2017
intersegmental vessel endothelial cell decreased amount, abnormal ci5Tg; y7Tg + MO2-ftr82 standard conditions Fig. 5 with image from Chang et al., 2017
intersegmental vessel decreased length, abnormal ci5Tg; y7Tg + MO2-ftr82 standard conditions Fig. 5 with image from Chang et al., 2017
Citations