Morpholino

MO3-shox

ID
ZDB-MRPHLNO-170124-2
Name
MO3-shox
Previous Names
None
Target
Sequence
5' - CGTGCAGAAGAAACTCACCGTCAGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-shox
No data available
Phenotype
Phenotype resulting from MO3-shox
Phenotype Fish Figures
head shox2 expression decreased amount, abnormal f1Tg + MO3-shox (AB/TU) Figure 1 with image from Hoffmann et al., 2026
head shox expression decreased amount, abnormal f1Tg + MO3-shox (AB/TU) Figure 1 with image from Hoffmann et al., 2026
heart shox2 expression decreased amount, abnormal f1Tg + MO3-shox (AB/TU) Figure 1 with image from Hoffmann et al., 2026
heart shox expression decreased amount, abnormal f1Tg + MO3-shox (AB/TU) Figure 1 with image from Hoffmann et al., 2026
heart nppb expression increased amount, abnormal f1Tg + MO3-shox (AB/TU) Figure 2 with image from Hoffmann et al., 2026
heart nppa expression increased amount, abnormal f1Tg + MO3-shox (AB/TU) Figure 2 with image from Hoffmann et al., 2026
pectoral fin shox2 expression decreased amount, abnormal f1Tg + MO3-shox (AB/TU) Figure 1 with image from Hoffmann et al., 2026
pectoral fin nppc expression decreased amount, abnormal f1Tg + MO3-shox (AB/TU) Figure 2 with image from Hoffmann et al., 2026
pectoral fin shox expression decreased amount, abnormal f1Tg + MO3-shox (AB/TU) Figure 1 with image from Hoffmann et al., 2026
pectoral fin decreased size, abnormal AB/TL + MO3-shox Fig. S3 from Montalbano et al., 2016
pectoral fin development disrupted, abnormal AB/TL + MO3-shox Fig. S3 from Montalbano et al., 2016
whole organism shox expression decreased amount, abnormal f1Tg + MO3-shox (AB/TU) Figure 1 with image from Hoffmann et al., 2026
whole organism shox2 expression decreased amount, abnormal f1Tg + MO3-shox (AB/TU) Figure 1 with image from Hoffmann et al., 2026
whole organism decreased length, abnormal AB/TU + MO3-shox Figure 3 with image from Hoffmann et al., 2026
whole organism nppa expression increased amount, abnormal f1Tg + MO3-shox (AB/TU) Figure 2 with image from Hoffmann et al., 2026
Phenotype of all Fish created by or utilizing MO3-shox
Phenotype Fish Conditions Figures
pectoral fin development disrupted, abnormal AB/TL + MO3-shox standard conditions Fig. S3 from Montalbano et al., 2016
pectoral fin decreased size, abnormal AB/TL + MO3-shox standard conditions Fig. S3 from Montalbano et al., 2016
whole organism decreased length, abnormal AB/TU + MO3-shox chemical treatment by environment: C-Type natriuretic peptide Figure 3 with image from Hoffmann et al., 2026
whole organism decreased length, abnormal AB/TU + MO3-shox control Figure 3 with image from Hoffmann et al., 2026
fin rasd1 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
whole organism her15.1 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin bmp4 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
whole organism shox2 expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
heart sox8a expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
whole organism cyp26c1 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
head cdkn1a expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin nppa expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin vgf expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin shox2 expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin cdkn1a expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin sox18 expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin sox6 expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin cdkn1ca expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
whole organism rasd1 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin her15.1 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
heart cdkn1a expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
whole organism cdkn1a expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin krt17 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
head cyp26c1 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin nppc expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin cyp26c1 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin cyp26b1 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin sox5 expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
heart cyp26c1 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
heart bmp4 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin sox8a expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
whole organism nppa expression increased amount, abnormal f1Tg + MO3-shox (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
whole organism shox2 expression decreased amount, abnormal f1Tg + MO3-shox (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
head shox2 expression decreased amount, abnormal f1Tg + MO3-shox (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
heart nppa expression increased amount, abnormal f1Tg + MO3-shox (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
pectoral fin shox expression decreased amount, abnormal f1Tg + MO3-shox (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
whole organism shox expression decreased amount, abnormal f1Tg + MO3-shox (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
pectoral fin shox2 expression decreased amount, abnormal f1Tg + MO3-shox (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
pectoral fin nppc expression decreased amount, abnormal f1Tg + MO3-shox (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
heart shox2 expression decreased amount, abnormal f1Tg + MO3-shox (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
heart shox expression decreased amount, abnormal f1Tg + MO3-shox (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
head shox expression decreased amount, abnormal f1Tg + MO3-shox (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
heart nppb expression increased amount, abnormal f1Tg + MO3-shox (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
whole organism nppa expression increased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
pectoral fin fgfr3 expression increased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 3 with image from Hoffmann et al., 2026
head shox2 expression decreased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
whole organism shox2 expression decreased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
pectoral fin nppb expression increased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
whole organism shox expression decreased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
whole organism fgfr3 expression increased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 3 with image from Hoffmann et al., 2026
pectoral fin nppc expression decreased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
pectoral fin shox2 expression decreased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
heart shox2 expression decreased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
head shox expression decreased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 1 with image from Hoffmann et al., 2026
heart nppb expression increased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
whole organism nppb expression increased amount, abnormal f1Tg + MO3-shox + MO3-shox2 (AB/TU) control Figure 2 with image from Hoffmann et al., 2026
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to report issues or recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.