Morpholino

MO1-irf4a

ID
ZDB-MRPHLNO-160115-2
Name
MO1-irf4a
Previous Names
  • irf4a MOatg (1)
Target
Sequence
5' - TGATGCAGTCCCCATCTAAGTTCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-irf4a
Expressed Gene Anatomy Figures
ccl25a Fig. 3 with image from Wang et al., 2015
ccl25b Fig. 3 with image from Wang et al., 2015
ccr9a Fig. 3 with image from Wang et al., 2015
coro1a Fig. 2 with image from Wang et al., 2015
csf3r Fig. 6 from Wang et al., 2015
foxn1 Fig. 3 with image from Wang et al., 2015
ikzf1 Fig. 2 with image,  Fig. 3 with image from Wang et al., 2015
lyz Fig. 5 with image,  Fig. 6 from Wang et al., 2015
mfap4.1 Fig. 5 with image from Wang et al., 2015
myb Fig. 2 with image,  Fig. 3 with image from Wang et al., 2015
spi1b Fig. 6 from Wang et al., 2015
Phenotype
Phenotype resulting from MO1-irf4a
Phenotype Fish Figures
hematopoietic system leukocyte EGFP expression increased amount, abnormal hkz04tTg + MO1-irf4a Fig. 5 with image from Wang et al., 2015
intermediate cell mass of mesoderm ccr9a expression decreased amount, abnormal WT + MO1-irf4a Fig. 3 with image from Wang et al., 2015
intermediate cell mass of mesoderm ccr9a expression decreased distribution, abnormal WT + MO1-irf4a Fig. 3 with image from Wang et al., 2015
intermediate cell mass of mesoderm leukocyte increased amount, abnormal hkz04tTg + MO1-irf4a Fig. 5 with image from Wang et al., 2015
intermediate cell mass of mesoderm macrophage increased amount, abnormal WT + MO1-irf4a Fig. 5 with image from Wang et al., 2015
intermediate cell mass of mesoderm neutrophil increased amount, abnormal WT + MO1-irf4a Fig. 5 with image from Wang et al., 2015
lymphoid lineage cell migration into thymus decreased process quality, abnormal hkz04tTg; nz50Tg + MO1-irf4a Fig. 3 with image from Wang et al., 2015
macrophage mfap4.1 expression increased distribution, abnormal WT + MO1-irf4a Fig. 5 with image from Wang et al., 2015
neutrophil lyz expression increased distribution, abnormal WT + MO1-irf4a Fig. 5 with image from Wang et al., 2015
thymus coro1a expression absent, abnormal WT + MO1-irf4a Fig. 2 with image from Wang et al., 2015
thymus myb expression absent, abnormal WT + MO1-irf4a Fig. 2 with image from Wang et al., 2015
thymus ikzf1 expression absent, abnormal WT + MO1-irf4a Fig. 2 with image from Wang et al., 2015
thymus EGFP expression absent, abnormal hkz04tTg + MO1-irf4a Fig. 2 with image from Wang et al., 2015
thymus ccr9a expression absent, abnormal WT + MO1-irf4a Fig. 3 with image from Wang et al., 2015
thymus hematopoietic stem cell migration decreased occurrence, abnormal hkz04tTg; nz50Tg + MO1-irf4a Fig. 3 with image from Wang et al., 2015
thymus leukocyte EGFP expression decreased amount, abnormal hkz04tTg + MO1-irf4a Fig. 5 with image from Wang et al., 2015
thymus leukocyte decreased amount, abnormal hkz04tTg + MO1-irf4a Fig. 5 with image from Wang et al., 2015
thymus leukocyte EGFP expression decreased distribution, abnormal hkz04tTg + MO1-irf4a Fig. 5 with image from Wang et al., 2015
thymus T cell absent, abnormal WT + MO1-irf4a Fig. 2 with image from Wang et al., 2015
thymus primordium EGFP expression absent, abnormal hkz04tTg; nz50Tg + MO1-irf4a Fig. 3 with image from Wang et al., 2015
whole organism spi1b expression increased amount, abnormal WT + MO1-irf4a Fig. 6 from Wang et al., 2015
whole organism lyz expression increased amount, abnormal WT + MO1-irf4a Fig. 6 from Wang et al., 2015
whole organism csf3r expression increased amount, abnormal WT + MO1-irf4a Fig. 6 from Wang et al., 2015
Phenotype of all Fish created by or utilizing MO1-irf4a
Phenotype Fish Conditions Figures
whole organism csf3r expression increased amount, abnormal WT + MO1-irf4a standard conditions Fig. 6 from Wang et al., 2015
macrophage mfap4.1 expression increased distribution, abnormal WT + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
intermediate cell mass of mesoderm ccr9a expression decreased distribution, abnormal WT + MO1-irf4a control Fig. 3 with image from Wang et al., 2015
intermediate cell mass of mesoderm macrophage increased amount, abnormal WT + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
thymus ccr9a expression absent, abnormal WT + MO1-irf4a control Fig. 3 with image from Wang et al., 2015
thymus T cell absent, abnormal WT + MO1-irf4a standard conditions Fig. 2 with image from Wang et al., 2015
neutrophil lyz expression increased distribution, abnormal WT + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
intermediate cell mass of mesoderm neutrophil increased amount, abnormal WT + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
thymus coro1a expression absent, abnormal WT + MO1-irf4a control Fig. 2 with image from Wang et al., 2015
whole organism lyz expression increased amount, abnormal WT + MO1-irf4a standard conditions Fig. 6 from Wang et al., 2015
intermediate cell mass of mesoderm ccr9a expression decreased amount, abnormal WT + MO1-irf4a control Fig. 3 with image from Wang et al., 2015
whole organism spi1b expression increased amount, abnormal WT + MO1-irf4a standard conditions Fig. 6 from Wang et al., 2015
thymus ikzf1 expression absent, abnormal WT + MO1-irf4a control Fig. 2 with image from Wang et al., 2015
thymus myb expression absent, abnormal WT + MO1-irf4a control Fig. 2 with image from Wang et al., 2015
hematopoietic system leukocyte EGFP expression increased amount, abnormal hkz04tTg + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
thymus leukocyte EGFP expression decreased amount, abnormal hkz04tTg + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
intermediate cell mass of mesoderm leukocyte increased amount, abnormal hkz04tTg + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
thymus EGFP expression absent, abnormal hkz04tTg + MO1-irf4a control Fig. 2 with image from Wang et al., 2015
thymus leukocyte EGFP expression decreased distribution, abnormal hkz04tTg + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
thymus leukocyte decreased amount, abnormal hkz04tTg + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
lymphoid lineage cell migration into thymus decreased process quality, abnormal hkz04tTg; nz50Tg + MO1-irf4a control Fig. 3 with image from Wang et al., 2015
thymus primordium EGFP expression absent, abnormal hkz04tTg; nz50Tg + MO1-irf4a control Fig. 3 with image from Wang et al., 2015
thymus hematopoietic stem cell migration decreased occurrence, abnormal hkz04tTg; nz50Tg + MO1-irf4a control Fig. 3 with image from Wang et al., 2015
thymus hematopoietic multipotent progenitor cell decreased amount, abnormal zf169Tg + MO1-irf4a control Fig. 2 with image from Wang et al., 2015
myeloid cell differentiation increased occurrence, abnormal nz50Tg; zf169Tg + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.