Morpholino

MO2-scn1lab

ID
ZDB-MRPHLNO-150720-3
Name
MO2-scn1lab
Previous Names
None
Target
Sequence
5' - CTGAGCAGCCATATTGACATCCTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-scn1lab
No data available
Phenotype
Phenotype resulting from MO2-scn1lab
Phenotype Fish Figures
brain functionality, abnormal AB + MO2-scn1lab Fig. 3 with image from Zhang et al., 2015
brain glutamatergic neuron GFP expression increased amount, abnormal nns14Tg; nns25Tg + MO2-scn1lab Figure 3 with image from Brenet et al., 2019
brain glutamatergic neuron increased ratio brain GABAergic neuron, abnormal nns14Tg; nns25Tg + MO2-scn1lab Figure 3 with image from Brenet et al., 2019
brain neuron decreased amount, abnormal nns14Tg; nns25Tg + MO2-scn1lab Figure 3 with image from Brenet et al., 2019
brain postsynapse Ab7-gphn labeling decreased distribution, abnormal WT + MO2-scn1lab Figure 2 with image from Brenet et al., 2019
brain postsynapse ab1-dlg4 labeling increased distribution, abnormal WT + MO2-scn1lab Figure 2 with image from Brenet et al., 2019
calcium-mediated signaling increased occurrence, abnormal zf498Tg + MO2-scn1lab Figure 1 with image from Brenet et al., 2019
glutamatergic neuron apoptotic process increased occurrence, abnormal nns14Tg; nns25Tg + MO2-scn1lab Figure 4 with image from Brenet et al., 2019
locomotion increased occurrence, abnormal AB + MO2-scn1lab Fig. 1 with image from Zhang et al., 2015
locomotory behavior process quality, abnormal AB + MO2-scn1lab Fig. S1,  Fig. S2 from Zhang et al., 2015
neuron apoptotic, abnormal nns14Tg; nns25Tg + MO2-scn1lab Figure 4 with image from Brenet et al., 2019
neuronal signal transduction amplitude, abnormal zf498Tg + MO2-scn1lab Figure 1 with image from Brenet et al., 2019
neuronal signal transduction increased occurrence, abnormal zf498Tg + MO2-scn1lab Figure 1 with image from Brenet et al., 2019
swim bladder uninflated, abnormal AB + MO2-scn1lab Fig. 1 with image from Zhang et al., 2015
whole organism increased behavioural activity, abnormal AB + MO2-scn1lab Fig. S1 from Zhang et al., 2015
whole organism increased pigmentation, abnormal AB + MO2-scn1lab Fig. 1 with image from Zhang et al., 2015
whole organism anatomical axis curved, abnormal AB + MO2-scn1lab Fig. 1 with image from Zhang et al., 2015
Phenotype of all Fish created by or utilizing MO2-scn1lab
Phenotype Fish Conditions Figures
whole organism anatomical axis curved, abnormal AB + MO2-scn1lab standard conditions Fig. 1 with image from Zhang et al., 2015
whole organism increased behavioural activity, abnormal AB + MO2-scn1lab standard conditions Fig. S1 from Zhang et al., 2015
brain functionality, abnormal AB + MO2-scn1lab standard conditions Fig. 3 with image from Zhang et al., 2015
swim bladder uninflated, abnormal AB + MO2-scn1lab standard conditions Fig. 1 with image from Zhang et al., 2015
thigmotaxis disrupted, abnormal AB + MO2-scn1lab heat shock Fig. 5 with image from Zhang et al., 2015
locomotory behavior process quality, abnormal AB + MO2-scn1lab standard conditions Fig. S1,  Fig. S2 from Zhang et al., 2015
whole organism increased pigmentation, abnormal AB + MO2-scn1lab standard conditions Fig. 1 with image from Zhang et al., 2015
locomotion increased occurrence, abnormal AB + MO2-scn1lab standard conditions Fig. 1 with image from Zhang et al., 2015
neuromuscular process controlling posture disrupted, abnormal AB + MO2-scn1lab heat shock Fig. 5 with image from Zhang et al., 2015
brain postsynapse Ab7-gphn labeling decreased distribution, abnormal WT + MO2-scn1lab standard conditions Figure 2 with image from Brenet et al., 2019
brain postsynapse ab1-dlg4 labeling increased distribution, abnormal WT + MO2-scn1lab standard conditions Figure 2 with image from Brenet et al., 2019
neuronal signal transduction increased occurrence, abnormal zf498Tg + MO2-scn1lab standard conditions Figure 1 with image from Brenet et al., 2019
calcium-mediated signaling increased occurrence, abnormal zf498Tg + MO2-scn1lab standard conditions Figure 1 with image from Brenet et al., 2019
neuronal signal transduction amplitude, abnormal zf498Tg + MO2-scn1lab standard conditions Figure 1 with image from Brenet et al., 2019
brain glutamatergic neuron increased ratio brain GABAergic neuron, abnormal nns14Tg; nns25Tg + MO2-scn1lab standard conditions Figure 3 with image from Brenet et al., 2019
glutamatergic neuron apoptotic process increased occurrence, abnormal nns14Tg; nns25Tg + MO2-scn1lab standard conditions Figure 4 with image from Brenet et al., 2019
brain glutamatergic neuron GFP expression increased amount, abnormal nns14Tg; nns25Tg + MO2-scn1lab standard conditions Figure 3 with image from Brenet et al., 2019
neuron apoptotic, abnormal nns14Tg; nns25Tg + MO2-scn1lab standard conditions Figure 4 with image from Brenet et al., 2019
brain neuron decreased amount, abnormal nns14Tg; nns25Tg + MO2-scn1lab standard conditions Figure 3 with image from Brenet et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.